Labshake search
Citations for Promega :
101 - 150 of 5108 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... seedlings were sprayed with a 5 mM D-Luciferin (Promega, USA), 0.01 % Triton X-100 solution ...
-
bioRxiv - Cell Biology 2020Quote: ... washed again in DPBS and stained with 1mg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-galactopyranoside, Promega, Madison, WI, US) in DMF (Dimetil formamide ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was revealed with a solution of NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate) (Promega, Madison, WI, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was assayed 6 d after compound addition with the CellTiter-Glo reagent (Promega). Luminescence well values were normalized to DMSO-treated wells by subtracting per-plate average DMSO log2-luminescence values from the log2-luminescence values of each treatment well.
-
bioRxiv - Cancer Biology 2022Quote: ... The migrated cells were collected at 4h and quantified with Cell Titre-Glo 2.0 reagent (#G9241, Promega). For inhibitor experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... and samples were digested over night with Lys-C (Wako) followed by 4h digestion with Trypsin (Promega) at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... The transfected cells were then treated with Aβ42 (1-4 μM) or calcitriol (100 nM) for 6 h before luciferase activity assay (Dual-Luciferase Reporter Assay, Promega). A 587-bp region of the human Cyp24a1 gene promoter that contains two VDRE motifs was cloned into the promoter-less luciferase expression vector pGL3-basic (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10μM amino acids (Promega), 0.21mM spermidine ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 250 µL (1:1 volume) of One-Glo reagent (E6110, Promega) was added to each well and incubated for 10 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 75 µL (1:1 volume) of One-Glo reagent (E6110, Promega) was added to each well and incubated for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... apoptosis was quantified using the Apo-ONE homogeneous caspase-3/7 assay kit (Promega, Madison, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Immunology 2021Quote: ... cells were transfected with one of the Gag-mCherry variants (8 µg) using FuGene HD according to the manufacturer’s instructions (Promega, USA) in a 3:1 ratio with DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 8 µg of pcDNA3.1-GFP-mNLS-K145Q using Fugene 6 Transfection reagent (Promega, E2692) per manufacturer protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Immunology 2023Quote: ... prepared by combining ONE-Glo™ EX Luciferase Assay Buffer with ONE-Glo™ EX Luciferase Assay Substrate in 1:1 ratio (Promega, USA). After measuring the signal of the Firefly luciferase in the GloMax® 20/20 Luminometer (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μl of premix [100 μM amino acid mixture minus methionine (Promega), 100 μM amino acid mixture minus leucine (Promega) ...
-
bioRxiv - Plant Biology 2023Quote: ... sprayed with 1 mM D-luciferin (Promega) and kept in dark for 10 min before detection by using ChecmiDoc MP machine (BioRad).
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 75 μL (1:1 volume) of One-Glo™ reagent (E6110, Promega) was added to each well ...
-
bioRxiv - Cancer Biology 2020Quote: ... was determined at day 3 and 4 post-transfection using the Caspase-Glo 3/7 Assay (Promega, Mannheim, Germany). The emerging fluorescence was detected (485Ex/527Em ...
-
bioRxiv - Cancer Biology 2022Quote: ... ATP levels were measured using the CellTiter-Glo 3-D Reagent (Promega, catalog no. G9681) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... after which growth media was removed and 20 µl of 4% D-luciferin (Promega) in CO2 independent medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forty-eight hours later, cells were treated with Thapsigargin (100nM, 4h) and cells were resuspended in passive lysis buffer (Promega). Firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (#E1960 ...
-
bioRxiv - Biochemistry 2022Quote: ... The samples were then diluted to 6 M urea with 50 mM Tris-HCl pH 8 and Trypsin/Lys-C mix (Promega) was added to an enzyme:substrate ratio of 1:25 (w/w ...
-
bioRxiv - Microbiology 2023Quote: ... 8 × 105 HEK293T cells/well were seeded into 6-well plates and transfected the next day with ViaFect (Promega, E4981), using either 4 μg of plasmid expressing the G protein or 2 μg of plasmid expressing HA together with 2 μg of plasmid expressing NA ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.4 mM amino acid mixture (Promega) and 1 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 67 µM amino acid mixture (Promega), 1x cOmplete protease inhibitors EDTA-free ...
-
bioRxiv - Biophysics 2019Quote: ... 10 µM amino acids mixture (Promega), 1 U/µL murine RNase inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid mix lacking Met (Promega) and 0.1 × volume of an in vitro transcribed mRNA (200-1,000 ng/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 mM amino acid mixture (Promega) and 1 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 μM amino acid mix (Promega), and 2mM DL-dithiothreitol ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 μM amino acid mixture (Promega), 50 μM Spermidine ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μM amino acids mixture (Promega), 1 u/μl RiboLock RNase inhibitor (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... The cell suspension was mixed 1:1 with ONE-GloTM Luciferse Assay Buffer (Promega), and the luminescence was measured with the Synergy HTX Multi-Mode Reader ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...