Labshake search
Citations for Promega :
451 - 500 of 3605 citations for 5 NAPHTHALEN 1 YL 2H PYRAZOL 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 μM HaloTag-TMR substrate (Promega) and incubated for 15 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 µg of K562 cell lysate (Promega) or 5 µg yeast digests were injected and run on a nanoAcquity UPLC (Waters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 5 % BrightGlo (Promega, Madison, WI, USA) before reading luminescence on a Molecular Devices SpectraMax iD5 with a 1 second integration time ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg of trypsin (Promega, Sequence Grade) was added and digestion was performed overnight at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Trypsin (5 μg/ml trypsin gold (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2021Quote: ... 4.0 µL of 5× GoTaq Buffer (Promega), 2.0 µL of MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μl of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL GoTaq polymerase buffer 5x (Promega), 0.5 μL of each primer ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated 5 minutes with AttoPhos (Promega). Images were acquired with a FLA-5000 fluorescent image analyzer (Fujifilm ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5% pRL-TK Luc (Promega E2241) plasmid and 100 µL of the transfected cell suspension were seeded into a white PDL-coated 96-well flat bottom plate (Nunc) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µl of the RT product (diluted 1:5) was used for semi-quantitative PCR or qPCR reactions with Promega PCR Mix (Promega, Madison, Wisconsin, USA) and SYBR Green PCR Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: 25μL of Caspase-Glo®-3/7 or −8 reagent (Promega) was added to 5μg (Caspase-3/7 activity ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 50 µL of Caspase-3/7 Glo Reagent (ProMega, Madison, WI) was added to each well to yield a 100 µL total volume ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Then 5 μL of MTase reagent B (Promega) were added to all of the wells ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...