Labshake search
Citations for Promega :
601 - 650 of 1880 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
MYB insufficiency disrupts proteostasis in hematopoietic stem cells leading to age-related neoplasiabioRxiv - Cancer Biology 2021Quote: RNA was extracted from sorted KSL cells using TRIzol and converted to cDNA using M-MLV reverse transcriptase (Promega, Madison WI). Quantitative PCR was performed using Taqman (Applied Biosystems ...
-
bioRxiv - Systems Biology 2019Quote: ... The sample was diluted with 100 mM tris to a final urea concentration of 1.5 M urea and digested with trypsin (Promega, Madison, WI) overnight at room temperature (1:50 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg of RNA per sample was reverse transcribed to cDNA in a 20 μl reaction using M-MLV reverse transcriptase (Promega, USA) and random primers (Invitrogen) ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2021Quote: ... and the extracted mRNA was used as a template for reverse transcription using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Virus was quantified using real-time PCR using SYBR Premix Ex Taq™ (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genome copy number was calculated using a standard curve prepared with vector DNA consisting of the SH or M gene cloned into pGEM®-T Easy (Promega) and expressed as log10 genome equivalents/ml of eluted RNA.
-
bioRxiv - Systems Biology 2022Quote: ... The urea concentration was then diluted to 1 M with 50 mM ABC and the proteins digested with trypsin (Promega, V511c) at 1:100 mass-ratio at 37 °C overnight.
-
bioRxiv - Systems Biology 2019Quote: ... The samples were then diluted with 0.1 M NH4HCO3 to a final concentration of 1 M urea and the proteins were digested with sequencing-grade porcine trypsin (Promega, Switzerland) at a final enzyme:substrate ratio of 1:100 (w/w) ...
-
bioRxiv - Plant Biology 2019Quote: ... Messenger RNAs were purified from 40μg of total RNA using TYGR Dynabeads® oligo dT25 and subsequently used for cDNA synthesis using 200u of M-MLV (Promega), following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... RNA concentration was determined by NanoDrop 1000 Spectrophotometer (ThermoScientific).1 µg of total RNA was reverse transcribed into cDNA with M-MLV Reverse Transcriptase 200 units (Promega, #M1701), Random Primer 0.5 μg (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA (1 μg) was reverse-transcribed using oligo(dT)18 and M-MLV reverse transcriptase II (Promega, Fitchburg, WI, USA).
-
bioRxiv - Neuroscience 2022Quote: ... 1 µg of RNA per sample was reverse transcribed to cDNA in a 20 µl reaction using M-MLV reverse transcriptase (Promega, USA) and random primers (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by incubating the proteins first with endoproteinase Lys-C (Wako, #125-05061,)) in 8 M urea for 4h at 37°C followed by an overnight trypsin digestion (Promega #V511A,) in 2 M urea at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA (1 μg) was reverse-transcribed using oligo(dT)18 and M-MLV reverse transcriptase II (Promega, Fitchburg, WI, USA).
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of total RNA was reverse transcribed with M-MLV reverse transcriptase using random primers according to the manufacturer’s protocol (Promega, Madison, USA). qRT-PCR was performed in a 25 μl reaction volume containing ...
-
bioRxiv - Biochemistry 2023Quote: ... The reaction was quenched with DTT and urea was diluted to <1 M with 50 mM NH4HCO3 before adding MS-grade trypsin (Promega, V5113) in a ratio of 1:25 (trypsin:protein ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then resuspended in 30 μL of 8 M Urea and 30 μL of ProteaseMax surfactant (20 μg/mL in 100 mM ammonium bicarbonate, Promega, V2071).
-
bioRxiv - Plant Biology 2024Quote: ... Reverse transcription was achieved from 1 𝜇g of total RNA with M-MLV reverse transcriptase (RNase H minus, Point Mutant, Promega, USA) using an anchored oligo(dT)20 primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of sequencing grade trypsin (Promega) was then added to the samples and they were digested overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: The psiCHECK-2 control vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3′ UTR vector were described before26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL dNTP (Promega U151B, 2.5 mM), 1.5 µL MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.05 μg LgBiT-β-arrestin-2 (Promega) plus 0.9 µg pcDNA3.1 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of luciferin reagent (Promega BrightGlo) was added and luciferase activity detected (Perkin Elmer Envision) ...