Labshake search
Citations for Promega :
1 - 50 of 4181 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
bioRxiv - Microbiology 2021Quote: ... and pVSV-G (4:3:1 ratio) using calcium phosphate transfection (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 175 μg/ml 5-bromo-4-chloro-3- indolyl-phosphate (BCIP) (Promega). Reactions were stopped as the signal became apparent with three PBS rinses ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
bioRxiv - Microbiology 2024Quote: ... the MTS solution (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (Promega # G3581) was added to individual wells ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated proteins were digested with 1:50 w/w LysC (Wako Chemicals, cleaves at the carboxylic side of lysine residue) and 1:100 w/w trypsin (Promega, Sequencing-grade ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) inner salt (Promega) was added to each well and the plate was further incubated for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μL of [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) (Promega, #G3582) were added and incubated at 37°C for 3 hours ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
bioRxiv - Microbiology 2021Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
-
bioRxiv - Microbiology 2023Quote: ... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... and cells were transfected with 400 ng of promoter luciferase construct or cotransfected with a 1:4 ratio of promoter luciferase to expression plasmid using Fugene 6 (5:1 transfection reagent to DNA, Promega). pcDNA3.1 empty vector was used as carrier DNA during transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Bioengineering 2023Quote: ... The effect on cell viability of PTNP was assessed using the MTS [(3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] assay (CellTiter 96 cell proliferation assay kit; Promega, WI, USA) (92) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... MTS ([3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (#G3581) was purchased from Promega (Charbonnières-les-Bains, France).
-
bioRxiv - Microbiology 2020Quote: ... membranes were incubated in a 0.165 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate, Promega)/ 0.33 mg/ml NBT (p-nitroblue tetrazolium chloride ...
-
bioRxiv - Genomics 2020Quote: ... 4 µL RNase-A (4 mg-mL-1, Promega, Madison WI) was incubated at 37 °C for one hour vortexing every 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 4 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Genetics 2024Quote: ... using primers 5’-TCCCTTCCTTCAAGGCTACA-3’ and 5’-GTTAGGAGCCAGAGCAGCAC-3’ and the Go-Taq Flexi DNA Polymerase (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Immunology 2024Quote: ... immunoreactive bands were detected using nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Promega, Madison, WI, USA), for human cells and mBMDM ...
-
bioRxiv - Cell Biology 2024Quote: ... Reagents 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) were from Promega (Madison, WI). The inhibitors of protein synthesis cycloheximide (CXH) ...
-
bioRxiv - Bioengineering 2024Quote: ... 10μM of 2-(4-Morpholinyl)-8-phenyl-4 H-1-benzopyran-4-one (Ly294002: Promega, #V120A), 50ng/ml of Activin A (Stemcell Technologies ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Bioengineering 2022Quote: ... To determine the optimum transfection ratio multiple complexes were created (1.5:1, 3:1, 6:1) using ViaFect Transfection reagent (Promega, E4981) and pGL4.51 [luc2/CMV/Neo] plasmid vector (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM NaCl, 3 mM MgCl2, 1% BSA, 0.1% Tween-20, 1 mM DTT and 1 U/uL RnaseIn, Promega©) was added to the lysed cells ...