Labshake search
Citations for Promega :
351 - 400 of 6642 citations for 3' 3' Cyclic GAMP cGAMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... PAO1-WT and few colonies that grew in 3 mM 22D-chelated condition were isolated and gDNA extracted using Wizard® Genomic DNA Purification Kit (Promega, USA) for use in whole genome sequencing ...
-
bioRxiv - Bioengineering 2023Quote: ... The effect on cell viability of PTNP was assessed using the MTS [(3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] assay (CellTiter 96 cell proliferation assay kit; Promega, WI, USA) (92) ...
-
bioRxiv - Cell Biology 2023Quote: ... or mutant β2AR INTAL and a plasmid encoding a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Microbiology 2020Quote: ... Assays were harvested on day 3 using BrightGlo luciferase reagent (Promega, Madison, WI) and luminescence detected with a Victor luminometer (PerkinElmer ...
-
bioRxiv - Pathology 2019Quote: ... RNA (3 μg) was retro-transcripted by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was analyzed using Caspase-Glo 3/7 Assay (Promega, Madison, WI), according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were embedded in 3% low melting point agar (Promega, Madison, WI, USA). Formalin embedding ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 3 μg of DNA using FuGENE HD (Promega; E2311). Cells
-
bioRxiv - Biochemistry 2022Quote: ... Apoptosis was measured using the Caspase-Glo® 3/7 assay system (Promega). Cells were seeded at a density of 1 × 104 in 96-well black polystyrene microplates (Corning) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 175 μg/ml 5-bromo-4-chloro-3- indolyl-phosphate (BCIP) (Promega). Reactions were stopped as the signal became apparent with three PBS rinses ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was measured with the caspase-Glo 3/7 assay (Promega Cat# G8092), following manufacturer recommendations.
-
bioRxiv - Molecular Biology 2022Quote: Active caspases were detected using the Caspase-Glo 3/7 Assay System (Promega). The experiment was set up using the same protocol as proliferation assay ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and incubated at 37 °C for 3 h with Trypsin/Lys-C (Promega) at a 25:1 protein:protease ratio (w/w) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Flo (Promega) or CaspaseGlo (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMRXIH together with 3×FLAG tag or HaloTag7 (N2701, Promega, Madison, WI). DNA fragments encoding ATG2A (NM_015104.3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Glo (Promega) or Caspase Glo (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA (3 μg) was retro-transcribed by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Bioengineering 2023Quote: ... the Caspase-Glo 3/7® or Caspase-Glo 8® assay (Promega) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... and CTNNB1 exon 3 was amplified using GoTaqβ G2 Flexi DNA Polymerase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 mg of RNA was reverse-transcribed with M-MLV (Promega, Madison, WI). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... After 3-minute incubation we added 30 µl of NanoGlo Luciferase substrate (Promega) per well and nano luciferase activity was measured by Centro XS3 LB 960 luminometer (Berthold Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... and apoptosis was determined using the Caspase 3/7 Glo Assay (G8090, Promega) measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent ...