Labshake search
Citations for Promega :
451 - 500 of 1516 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (qPCR) was performed with the primers listed in Table S1 and a GoTaq qPCR Master Mix (Promega, A6002) in a Mastercycler realplex2 thermocycler (Eppendorf) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The synthesized cDNA was served as the template for qPCR and the GoTaq® qPCR Master Mix (A6001, Promega, USA) was used ...
-
bioRxiv - Plant Biology 2020Quote: ... The concentrations of the resulting cDNAs were adjusted to 10 ng/µL and 2 µL were used for RT-qPCR reactions performed with the GoTaq qPCR Master Mix (Promega) in a final volume of 10 µL ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-30 ng of the original RNA was used to perform qPCR for Dkk3 and Dkk1 using GoTaq qPCR Master Mix (Promega) in a CFX96 Bio-rad system following the manufacturer’s protocol (2 min at 95°C followed by 40 cycles of denaturing at 95°C and annealing/extension at 60°C) ...
-
bioRxiv - Biochemistry 2023Quote: ... and used 1 μL of cDNA for 10 μL of PCR using 2x GoTaq master mix (Promega) and 250 nM of forward and reverse primer sets with conditions recommended by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Two-rounds of translocation PCR was performed using GoTaq G2 Green Master Mix (Promega). In the first round PCR ...
-
bioRxiv - Immunology 2021Quote: ... mouse tail DNA was amplified using GoTaq G2 Green Master Mix (Promega, cat. M7823) or KAPA Taq PCR Kit (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Twenty-five ul reactions were prepared using 12.5ul GoTaq G2 Green Master Mix (Promega), 0.5ul 10mg/ml bovine serum albumin ...
-
bioRxiv - Bioengineering 2020Quote: ... and for diagnostic PCR reactions (GoTaq® Green Master Mix (Promega; Art. No.:M7845). PCR was performed according to the respective manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1x of GoTaq® G2 Green Master Mix (Promega™, Madison, Wisconsin, USA). PCR amplification was done using the following PCR cycling conditions ...
-
bioRxiv - Bioengineering 2020Quote: ... Genotyping PCR assays were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA). The oligonucleotides used in this study (Supplementary Table 8 ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA template was used for PCR reaction with GoTaq Green Master Mix (Promega). The primers for RT-PCR are listed in Supplemental Table S1.
-
bioRxiv - Microbiology 2020Quote: ... Resulting colonies were screened by colony PCR using GoTaq Green PCR master mix (Promega), with 1 µl of Pk5’ UTR forward and Pk3’UTR reverse primers for each respective construct ...
-
bioRxiv - Developmental Biology 2019Quote: PCR amplification was performed using GoTaq G2 Hot Start Green Master Mix kit (Promega) in a 25 µL standard reaction mix and the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... and parental allele-specific PCR probes and GoTaq Green Master Mix (Promega cat.#M712). Clones that tested positive by PCR were further validated by western blotting for eS25 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR was run for 30 cycles using GoTaq® G2 Green master mix (Promega) and specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... a PCR reaction was performed using the GoTaq® G2 Green Master mix (Promega) and primers specific for the housekeeping gene Actin1 (ACT1 ...
-
bioRxiv - Genomics 2023Quote: ... 20 ml PCR reactions contained 10 ml GoTaq® green PCR Master mix (Promega), 6 ml nuclease-free water ...
-
bioRxiv - Neuroscience 2024Quote: ... genotyping PCR was performed using Go Taq Green Master Mix (Promega, Madison, WI, USA) with the following four primer sets ...
-
bioRxiv - Neuroscience 2021Quote: ... The reverse-transcribed cDNA was subjected to quantitative PCR using GoTaq qPCR Master Mix (Promega) and the StepOnePlus™ Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and gene expression levels measured using a 1-step RT-qPCR master mix (Promega, UK) and a 7500 Fast qPCR instrument (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Complement DNA (cDNA) templates were then analyzed using GoTaq® qPCR Master Mix (Promega Corporation) on a LightCycler® 480 Instrument II (Riche Life Science) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR reactions were carried out using 1x GoTaq™ qPCR Master Mix (Promega) and 0,25 μM of forward and reverse primers (Table S5 ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative real-time PCR was carried out according to the GoTaq qPCR Master Mix (Promega) with 20 µl of a reaction mixture containing gene-specific primers (Supplementary Table 3) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Equal amounts (according to PCR quantification) were used with the GoTaq qPCR Master Mix (Promega) in a 7300 real-time PCR system (ABI) ...
-
bioRxiv - Genomics 2019Quote: ... Quantitative PCR was performed in 3 technical replicates with the GoTaq qPCR Master Mix (Promega) in 384 well plates ...
-
bioRxiv - Immunology 2021Quote: ... quantitative real-time PCR was carried out using the GoTaq qPCR Master Mix kit (Promega) with 20 µL of reaction mixture containing gene-specific primers or the PrimePCR assay kit (Bio-Rad ...
-
bioRxiv - Biophysics 2022Quote: ... Amplification was performed as previously described [58] using GoTaq qPCR Master Mix (Promega, Madison, USA) and specific oligonucleotide primers (EUB 27F ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples and standard curves were prepared using GoTaq qPCR Master Mix (Promega, Madison, Wisconsin, USA) and gene specific primers (Integrated DNA Technologies ...
-
bioRxiv - Physiology 2024Quote: ... Real-time PCR reaction was performed with the GOTaq® qPCR Master Mix (A6001, Promega) and CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2024Quote: ... The quantitative real-time PCR was performed using the GoTaq qPCR Master Mix kit (Promega) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2024Quote: Quantitative real-time PCR (RT-qPCR) was performed using GoTaq PCR Master Mix (Promega, #A6002) and specific primers listed below ...
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCRs were carried out by loading the same volume of DNA per sample and using GoTaq® qPCR Master Mix (Promega). Details of human-specific primers used are available in supplementary table S3.
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The samples were resuspended in 30 uL of TE buffer and amplified by qPCR using GoTag qPCR Master Mix (Promega #A6001), using as amplicons the p53RE for the rpr and hid genes ...
-
bioRxiv - Molecular Biology 2020Quote: ... EPOP and Ser5-RNAPII and quality control of all immunoprecipitated DNA samples were tested by qPCR using GoTaq® qPCR Master Mix (Promega) with a QuantStudio 6 Flex Real-time PCR System (Applied Biosystems) ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... Quantitative PCR (qPCR) was then performed on LightCycler 480 Real-Time PCR System using the GoTaq qPCR Master Mix (Promega, #A6001), and the primers pairs are listed in Table S7 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 ng of cDNA of each sample was used for the qPCR reaction (duplicate/sample) with ENG or α-tubulin specific primers (Supp. Table 1) and the GoTaq qPCR Master mix (Promega), in presence of CXR reference dye ...
-
bioRxiv - Genetics 2020Quote: ... PCR was performed in 15 µl reactions using 2x GoTaq DNA Polymerase master mix (Promega Cat. No. M3008) with 5 ng of gDNA and 500 nM of each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR amplifications for genotyping were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA), with the resulting products subjected to 3% agarose gel electrophoresis (Supplemental Fig ...
-
bioRxiv - Genetics 2021Quote: ... then a 5 min final extension (72 °C)—using GoTaq Green Master Mix (M7123, Promega) and the pCFD6_seqfwd and pCFD6_seqrev primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... Successful integration was confirmed by diagnostic PCR using GOtaq Hot Start Green Master Mix (Promega). For primer sequences see Supplementary file 1.
-
bioRxiv - Microbiology 2019Quote: ... PCR to confirm presence of transposon was preformed using GoTaq® Green Master Mix (Promega) and primers KanF (TGGATTGCACGCAGGTTCTC ...
-
bioRxiv - Plant Biology 2021Quote: ... colony PCR screens were conducted using GoTaq® Green Master Mix (Promega, Madison WI, USA) with the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... USA). GoTaq Green Master Mix (Cat. No. M7123) was obtained from Promega (Madison, WI, US).
-
bioRxiv - Microbiology 2022Quote: ... PCR was carried out individually for each gene using GoTaq® Green Master Mix (Promega), with primers listed in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... individual rough colonies were used to conduct colony-PCR using GoTaq Green master mix (Promega) and a primer set unique to different regions on each of the BcG9241 plasmids pBCX01 and pBC210 ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR solution for each sample contained 12.5 µL GoTaq Green Master Mix (Promega, M7123), 1.5 µL common forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each DNA family was amplified with 2×GoTaq® Hot Start Green Master Mix (Promega) using 0.8–2.2 ng of germline and somatic DNA and the primer pair according to the manufacturer’s instructions ...