Labshake search
Citations for Promega :
201 - 250 of 4027 citations for 2 Arachidonoylglycerol 2 AG CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... before adding 2 µL of 0.5 ng/µL trypsin (Promega) in digestion buffer (50 mM TEAB ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein suspension was digested with 2 µg trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or pB.2-eIF2α-S51A plasmids by use of FuGENE6 (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Each reaction was treated with 2 units of RQ1 DNase (Promega) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μl of Trypsin/Lys-C mix (0.5μg/μl, Promega, V5073) was added to each sample and incubated for 3 hrs at RT in the dark ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C after adding 50 mM ammonium hydrogen carbonate to a final concentration of 1 M urea ...
-
bioRxiv - Plant Biology 2020Quote: ... from 2 μg RNA treated with RQ1 RNase-free DNase (Promega). The cDNA was then diluted 20 times in water and 5 μl of the dilution was used for the realtime qPCR analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were additionally diluted 2-fold and digested with trypsin (Promega, Sequencing Grade Modified Trypsin ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg Lys-C/Trypsin mix protease (Promega, Mass spec grade) were added to each sample (10 mM EPPS pH 8.5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RdRP products were treated with RNase I (2 U, Promega) at 37°C for 2 hours to digest single-stranded RNAs completely ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 2× GoTaq q-PCR master mix (Promega, USA) and 0.6 μM of AF77/78 or AF79/80 primer pairs targeting a region close to the Cori or to the terminus (ter) ...
-
bioRxiv - Genetics 2020Quote: ... 2 μg RNA were treated with RQ1 RNase-free DNase (Promega) followed by reverse transcription using M-MLV Reverse Transcriptase (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μg of MS grade Trypsin Platinum (Promega, Madison, WI, USA) in 40 μL of digestion buffer containing 50 mM TEAB was added into the filter and digested at 37°C for 16 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the nLuc released upon proteolytic cleavage of the receptor was measured on a plate reader Mithras LB 940 (Berthold Technologies ...
-
bioRxiv - Physiology 2023Quote: ... The assay medium was supplemented with 2% GloSensor Reagent (Promega #E1291) and 0.1% BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μM 11S and 2 μl furimazine solution (Promega Cat. # N1610) were added and the luminescence read at 1 min intervals for 10 min using the FLUOstar Omega using a gain value of 3,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids (2 μg /dish) were transfected using FuGENE6 transfection reagent (Promega), according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... Any remaining RNA was removed with 2 µl RNase A (Promega) added to a pool of DNA samples ...
-
bioRxiv - Physiology 2024Quote: The 2-DG glucose uptake for tissues was analyzed by Promega Glucose uptake-Glo assay method (#J1341) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the GoTaq 2-step RT-qPCR system (Promega, Madison, MA, USA) was utilized to perform cDNA synthesis and qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL/well of One-Glo detection reagent (Promega, cat # E6120) was added to all microplate wells via Multidrop ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µl of RNAse A solution (4 mg ml-1) (Promega) were added before incubation at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Crosslinks were reversed by addition of 2 uL Proteinase K (Promega) and incubation at 65 °C for 12-16 hours in a Thermomixer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X Primer extension buffer and 2 U AMV Reverse Transcriptase (Promega) were added to the annealing mixture and incubated for 1 hour at 42 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 ng of Renilla luciferase expressing pRL SV40 plasmid (E2231, Promega), as internal control ...
-
bioRxiv - Microbiology 2023Quote: Cell pellets resulting from later experiments (optimization of medium composition and fiber- and drug-testing) were pre-processed using the Maxwell® HT 96 gDNA Blood Isolation Kit (Promega AG, Dübendorf, Switzerland) combined with a FastPrep homogenizer (FastPrep-24TM ...
-
bioRxiv - Physiology 2019Quote: ... The wounded area and its surrounding area (2 x 2 cm) were immediately dissected out and RNA extraction was conducted using Maxwell® RSC simplyRNA Tissue Kit (AS1340, Promega, Madison WI) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The pEN-L1-AG-L2 vector was digested by EcoRV and ApaI (Promega) and purified from gel ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...