Labshake search
Citations for Promega :
401 - 450 of 2913 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were subjected to trypsin (Promega, Madison, WI) digestion overnight at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... proteins were digested by trypsin (1 µg, Promega) overnight at 24°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Puromycinylated proteins were subsequently visualized with AttoPhos (Promega) and scanned with an FLA-5000 fluorescent image analyzer (Fujifilm).
-
bioRxiv - Synthetic Biology 2024Quote: ... Proteins were digested using 0.5 µg trypsin (Promega) at 37 °C overnight under shaking (>1000 RPM) ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein solutions were digested using trypsin (Promega, V5280) at a ratio of 1:150 (w/w ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with transfection mix containing 50 μL FuGENE HD (Promega) and 1000 μL Opti-MEM (Thermofisher ...
-
bioRxiv - Pathology 2020Quote: ... respectively) containing β-galactosidase (1 mg/ml; Cat # V394A; Promega, Madison, WI). Samples were post fixed in formalin overnight and then stored in ethanol (70%).
-
bioRxiv - Cell Biology 2021Quote: ... containing 100 nM bafilomycin A1 and 37.5 nM TMRDirect Halo Ligand (Promega). After 2 hours in EBSS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pGL3-basic plasmid containing a reporter gene was purchased from Promega Co ...
-
bioRxiv - Physiology 2021Quote: ... pH 8) containing a cocktail of protease inhibitors (Promega Corporation, Madison, WI) using a Precellys24 and 2 mm zirconium oxide beads (2 x 25 s at 6800 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5% Sodium deoxycholate and 0.1% SDS) containing protease inhibitors (Promega, Madison, USA) and centrifuged at 10,000× g (30 min at 4°C) ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... this was assessed using a luciferase positive control pGL3 containing SV40 (Promega) and trypan blue staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... 80 µl of PNK buffer containing 4U Thermosensitive Alkaline Phosphatase (TSAP) (Promega) and 2µl RNasin® (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... dNTP nucleotide mix containing 200 µM concentrations of each nucleotide (Promega, USA), and 1.25U of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... and pGL4.74 containing the Renilla luciferase reporter gene (0.5 μg/dish, Promega), as an internal control ...
-
bioRxiv - Immunology 2020Quote: ... Washed beads were resuspended in 50mM ammonium bicarbonate containing 25ng trypsin (Promega) by brief bath sonication and incubated at 37°C O/N ...
-
bioRxiv - Immunology 2020Quote: ... followed by a medium change to supplemented DMEM containing 1µM luciferin (Promega). Data were further processed and analyzed using Chronostar 3.0 [49].
-
bioRxiv - Biophysics 2022Quote: ... and PiggyBac transposon plasmid containing puromycin selection using FuGENE (Promega, Madison, WI) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... containing flanking sequences that matched the pNL3.2NF-κB-RE plasmid (N111A, Promega). The pNL3.2NF-κB-RE plasmid was PCR amplified with primers containing sequences flanking the 5’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 25 μL of the HBSS containing GloSensor cAMP Reagent (Promega). Plates were kept in a dark place at room temperature for two hours to equilibrate cells with the reagent ...
-
bioRxiv - Microbiology 2024Quote: ... which included a 5 µl nucleotide mix containing 2.5 mM NTPs (Promega). For each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were incubated in media containing 50nM JF646 HaloTag ligand97 (Promega GA1120) or JFX554 HaloTag ligand98 (Kind gift of L ...
-
bioRxiv - Neuroscience 2024Quote: ... a solution containing 25 µg/mL of sequencing grade trypsin (Promega, USA) diluted in 20 mM ammonium bicarbonate (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ml DMEM containing 1 % (v/v) triton X-100 (Promega, UK) was then added to each well with vigorous pipetting to detach and disrupt cells from the well surface ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Microbiology 2024Quote: ... the MTS solution (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (Promega # G3581) was added to individual wells ...
-
bioRxiv - Plant Biology 2021Quote: ... The pSPUTK promoter allowed in vitro protein synthesis using the TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20µg of chromatin was subjected to buffer exchange through SP3 protein clean up protocol (87) and resuspended in AmBic-10mM DTT before proteins digestion with 1:50 trypsin (Promega V5280) for 18h ...
-
bioRxiv - Systems Biology 2024Quote: ... and an aliquot of approximately 25 µg of protein was digested with Trypsin (Promega, Trypsin to protein ratio of 1:50) at 37°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... antibody with HRP-conjugated anti-mouse secondary antibody (GE Healthcare or Promega). In addition to the experimental samples ...
-
bioRxiv - Plant Biology 2020Quote: ... an immunoblot with anti-halo antibody (Anti-HaloTag® Monoclonal Antibody-Promega) was performed to confirm protein expression and binding efficiency for each TF ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used are anti-HaloTag monoclonal antibody (Promega, G921A, 1:1000), and polyclonal rabbit antibodies ...
-
bioRxiv - Microbiology 2024Quote: ... as primary antibody and an anti-rabbit IgG HRP-conjugated antibody (Promega) as secondary antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of sequencing grade trypsin (Promega) was then added to the samples and they were digested overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: The psiCHECK-2 control vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3′ UTR vector were described before26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL dNTP (Promega U151B, 2.5 mM), 1.5 µL MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.05 μg LgBiT-β-arrestin-2 (Promega) plus 0.9 µg pcDNA3.1 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of luciferin reagent (Promega BrightGlo) was added and luciferase activity detected (Perkin Elmer Envision) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 U/µL RNasin Ribonuclease Inhibitor (Promega), 1.2 µM PrimeTime primers ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: Dual-luciferase assay (psiCHECK-2 vector, Promega) was selected to analyze the effects of the viral mutation on protein synthesis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with 2 µg Trypsin (Promega) overnight at 37 °C shaking at 1200 RPM on a thermomixer ...