Labshake search
Citations for Promega :
401 - 450 of 6853 citations for Mouse 60S ribosomal protein L22 like 1 RPL22L1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 0.025% deoxycholate and 200 µg.mL−1 RNase A at 37°C for 20 min to lyse the cells and Protein Precipitation Solution (Promega) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... the protein sample was digested by incubation with sequencing-grade modified trypsin (1/50, w/w; Promega, Madison, Wisconsin) overnight at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:3 with 50 mM HEPES pH 8.5 and then digested by a 1:50 (trypsin to protein) ratio of sequencing grade modified trypsin (Promega) for 16 hours at 600 rpm and 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... urea was diluted to 1 M and proteins digested overnight with modified sequencing grade trypsin (Promega, Madison, WI, USA) at a 1:50 enzyme:protein ratio ...
-
bioRxiv - Microbiology 2021Quote: ... PA) and AccuMap™ low pH protein digestion kit (with trypsin and lysC) and chymotrypsin (sequencing grade) were from Promega (Madison, WI). PreScisson protease was from GenScript (Piscataway ...
-
bioRxiv - Biophysics 2022Quote: ... The reaction was further incubated for 60 min at room temperature prior to measuring absorbance with a plate-reading luminometer (GloMax, Promega). Samples were correlated to phosphate concentration standard controls ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions (3 μL) were incubated for 60 min at 37 °C and quantified with the Nano-glo assay system (Promega).
-
bioRxiv - Microbiology 2021Quote: ... After 30 min at 60°C the samples were cooled to room temperature and 4 μg of Sequencing Grade Trypsin (Promega) for digestion were added ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured 60 h post-transfection using the Dual-Luciferase® Reporter Assay System (Promega GmbH, Mannheim, Germany) on an Infinite® M200 Pro (TECAN ...
-
bioRxiv - Cell Biology 2020Quote: ... gel pieces were reswelled in 60 μL of 50 mM NH4HCO3 buffer containing 10 ng/μL of trypsin (modified porcine trypsin sequence grade, Promega) incubated for one hour at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell plates were incubated at 37°C for 48-60 hours before 50 μL of CellTiter-Glo reagent (Promega) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... RT reaction was carried out in 15 ul reaction mixture at 40 °C for 60 min after addition of ImProm II (Promega). DNA fragments for L chain and the variable region of H chain (VH ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in 60 µl of 1x passive lysis buffer of the Dual-Luciferase Reporter Assay System (Promega, E1980) and directly assayed or frozen at −20°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... retrovirus vector containing chick U6 promoter which expresses shRNA for gfp or Plzf was transfected into M/O chicken strain-derived embryonic fibroblast cells (CEF) cultured in 60-mm dish using Fugene HD transfection regent (Promega). CEF was cultured in DMEM-high glucose containing 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 50°C for 60 min and 70°C for 15 min) in the presence of 10 fg of Luciferase RNA (Promega) using the SuperSript III reverse transcription kit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Luciferase reporter gene expression was quantified 60-72 h after infection upon lysis and the addition of Bright-GloTM Luciferase substrate (Promega). Data were retrieved from a BioTek microplate reader with Gen 5 software ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... and 60% of the lysis was used in measuring Firefly of Renilla luciferase activity with Dual-Glo Luciferase Assay System (Promega). The remaining 40% of the cell lysis was analyzed through Western blotting ...
-
bioRxiv - Cell Biology 2023Quote: ... gel pieces were reswelled in 60 mL of 50 mM NH4HCO3 buffer containing 10 ng/mL of trypsin (modified porcine trypsin sequence grade, Promega) incubated for one hour at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... luminescence photons were collected by accumulating the image for 60 s in the presence of 2 mM D-luciferin (Promega), and the luminescence signal was measured from the same varicosities as the corresponding fluorescence image ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell culture medium was replaced with pre-heated (37 °C) fresh medium containing EnduRen (60 µM) or 1x Nano-Glo Endurazine (Promega). Luciferase activity was measured using LuminoCell device ...
-
bioRxiv - Biochemistry 2023Quote: The gel pieces were then incubated with 60 µL of a 50 mM ammonium bicarbonate solution of trypsin (MS grade, Promega) at 4°C for 90 minutes and incubated at 37°C overnight ...
-
Parkinson’s VPS35[D620N] mutation induces LRRK2 mediated lysosomal association of RILPL1 and TMEM55BbioRxiv - Neuroscience 2023Quote: ... On-column digestion was performed by incubating 60 µL (1.5 µg) Trypsin/Lys-C Mix (Mass Spec Grade; Promega, UK) in 50 mM TEABC solution at pH 8 on the samples on a thermomixer at 47°C for 1 hour before reducing the incubation temperature to 22°C for overnight digestion ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were pre-incubated in Hanks’ balanced salt solution with increasing concentrations of compound for 60 minutes before stimulation with 10 nM CXCL12 and addition of 2 µM Renilla Luciferase substrate coelenterazine-h (Promega). After 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples (about 20 μg of protein) were digested with 500 ng of trypsin (Promega) and peptides were analysed by an Ekspert nanoLC 42 nanoflow system (Eksigent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were subjected to three wash periods for 5 minutes in 1x TBS with 0.5% Tween and then probed with horseradish peroxidase–conjugated goat anti-mouse or goat anti-rabbit secondary antibodies at 1:2,500 (W4021, W4011, Promega) in 1x TBS with 5% nonfat dry milk and 0.5% Tween at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... used at a 1:10,000 dilution and the secondary antibody was an Anti-Mouse IgG HRP conjugate antibody (Promega) also used at a 1:10,000 dilution.
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-HaloTag (Promega, G9211); rabbit anti-CIMPR (made in house) ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-Tag (Promega, G9211, mouse), and HSP90 (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2024Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Biochemistry 2021Quote: The kinase activity of the FLT3-ITD protein was measured by using ADP-Glo™ Kinase Assay Kit (Promega, Madison, Wisconsin, the US). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... SDC concentration was adjusted to 1% and 120 µg of proteins from each bacterial culture were digested by addition of trypsin (Promega) in a 1:50 (enzyme:protein ...
-
bioRxiv - Microbiology 2019Quote: Protein digestion - for samples processed with reagent 1 and 2 as well as for supernatants (proteomes) MS grade trypsin (Promega) was used at 1:1000 w/w protease:protein ...
-
bioRxiv - Bioengineering 2020Quote: ... In-solution protein digestion was carried out in a ratio of 1:25 w/w Trypsin/Lys-C (Mass Spectrometry Grade, Promega) to protein overnight at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns with cellular extracts were carried out as described for GFP-immunoprecipitations using 1-2 μg of GST-fused proteins bound to glutathione magnetic beads (Promega). For immunoprecipitations of recombinant proteins ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Cell Biology 2022Quote: ... The trapped proteins were washed four times with the methanol TEAB buffer and then digested using 1 µg Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... v/v) and dehydration in ACN, proteins were digested overnight at 37 °C with trypsin (1:50, w/w) (V5280, Promega). Peptides were extracted from the gel in 50% ACN/0.1% formic acid ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were digested either with trypsin in a trypsin/protein ratio of 1/50 (w/w) (Promega Cat. No. V5111) and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were diluted 8x in 50 mM ammonium bicarbonate to reduce the urea concentration to 1 M and protein digestion was performed overnight at 37 C by addition of 2 µg of trypsin (Promega) per sample.
-
bioRxiv - Plant Biology 2022Quote: ... were reduced with DTT and then alkylated with iodoacetamide and digested overnight using Lys-C/Trypsin (1:50, enzyme to protein; Promega). After terminating the digestion with 1% trifluoroacetic acid ...