Labshake search
Citations for Promega :
401 - 450 of 557 citations for FGF 7 Keratinocyte Growth Factor Human 163a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: MS-Compatible Human Protein Extract Digest (K562) was purchased from Promega (V6951), MassPREP E ...
-
bioRxiv - Cell Biology 2023Quote: ... human BLTP2/KIAA0100 ORF was amplified from pFN21A-Halo-KIAA0100 (FHC00016, Promega). An unstructured linker (sequence ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Microbiology 2020Quote: ... dahliae strain JR2 was isolated from tomato roots seven days after root dip inoculation and following five days of in vitro growth in soil extract and potato dextrose broth (PDB) using the Maxwell® 16 LEV Plant RNA Kit (Promega, Madison, USA). Real-time PCR was performed as described previously17 to determine the expression of effector genes relative to VdGAPDH with primer pairs as shown in Extended data Table 6.
-
bioRxiv - Cancer Biology 2020Quote: ... 1000 cells were seeded in 96-well plates with five replicates and the cell growth capacity was measured every day with the CellTiterBlue assay (#G8080, Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The primers were commercially synthesized (IDT) and tested on human genomic DNA (Promega) to confirm generation of only one amplicon product at the expected size ...
-
bioRxiv - Genetics 2020Quote: ... Deidentified healthy donor DNA was obtained from Promega (Human Genomic DNA: Female, G152A). DNA from ALS cases (ND11836 and ND13803 ...
-
bioRxiv - Cancer Biology 2020Quote: 2000bp human lncRNA-TANAR(ENST00000425110.1) promoter was cloned into PGL3 basic vectors (Promega). By mutating the crucial site of AR binding site in the lncRNA-TANAR 5’ promoter to EcoRI cutting site (-GAATTC) ...
-
bioRxiv - Immunology 2022Quote: Human LRBA was cloned in seven different fragments into pCIneo FLAG vectors (Promega). These plasmids were kindly provided by Dr ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... membrane integrity (CytoTox-OneTM homogeneous membrane integrity assay kit: lactate dehydrogenase (LDH release) and caspase activity/ apoptosis (Caspase-Glo® 3/7 assay system kit) (all from Promega, WI, USA), as described previously17 (see Supplementary data for detailed description).
-
bioRxiv - Bioengineering 2024Quote: ... 100 uL of the diluted lysate was added to each well along with an equal volume of Caspase Glo 3/7 assay reagent (Promega, Madison, Wisconsin, USA), according to the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and human 293T cells as producer cells using the FUGENE HD transfection reagent (Promega), as described [50] ...
-
bioRxiv - Pathology 2019Quote: ... human primary aortic SMCs were transfected with pGL4.34 Vector plasmids (E1350; Promega, Madison, WI) using Effectene Transfection Reagent (301425 ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... we used a 1/1500 artificial mix of promastigote DNA and human DNA (Promega) to reflect the median ratio found in clinical samples ...
-
bioRxiv - Neuroscience 2022Quote: Open reading frames of human OR genes were subcloned into pCI (Promega, WI, USA) with a Rho-tag (the sequence encoding the first 20 amino acids of rhodopsin ...
-
bioRxiv - Immunology 2023Quote: ... tailed with complete TRAC and TRBC1 gene segments amplified from human genomic DNA (Promega), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviral packaging vectors into human HEK-293T cells via calciumphosphate transfection (Promega; Madison, WI, USA), according to manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human SMARCB1 was translated in vitro using TNT Quick Coupled Transcription/Translation System (L1170, Promega). 1 µg of pcDNA3.1-FLAG-SMARCB1 was incubated at 30°C for 90 minutes with 20 µM methionine and TNT T7 Quick Master Mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cell lines were DNA fingerprinted for provenance using the Power-Plex 1.2 kit (Promega) and confirmed to be the same as the DNA fingerprint library maintained by ATCC ...
-
bioRxiv - Bioengineering 2021Quote: The open reading frame for human SOX17 was PCR amplified using GoTaq Master Mix (Promega) from the PB-TRE3G-SOX17 plasmid (Table S5) ...
-
bioRxiv - Genetics 2022Quote: ... human POPDC1 and POPDC2 cDNA sequences were cloned into the pFC14K or pFC32K plasmids (Promega), which contain C-terminus sequences for HaloTag and NanoLuc tags ...
-
bioRxiv - Molecular Biology 2020Quote: Human Genomic DNA was extracted from the blood using the Wizard Genomic DNA Purification kit (Promega) as per the instructions.
-
bioRxiv - Immunology 2021Quote: ... 25 μl of 7.5×104 Jurkat effector cells expressing either human FcγRIIIa or murine FcγRIV (Promega) resuspended in assay buffer were added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length human RNU6 sequence (110 nucleotides) was amplified by PCR and cloned into psiCHECK2 (Promega), downstream of Renilla luciferase ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA (gDNA) was extracted from human frontal cortex using Wizard Genomic DNA Purification Kit (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Standards for quantification were created by serial dilution of pre-quantified BSC human male DNA (Promega). Amplification reactions were performed in duplicate using 96 well-plates using a CFX96 Touch Real-time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: The region of interest (750-850 bp) was PCR amplified from pooled male human DNA (Promega) and cloned into a STARRseq luciferase validation vector_ORI_empty plasmid (Addgene plasmid #99298 ...