Labshake search
Citations for Promega :
401 - 450 of 4128 citations for 7 bromo 1 2 3 4 tetrahydroisoquinoline 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... using 1 - 2 µg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transfected with 1 – 2 μg EphA2-mTurquoise plasmid DNA using FuGene HD (Promega, #E2311) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... urea was diluted to 1 M by adding 50 mM ammonium bicarbonate and 2 μg Trypsin (Promega) per 100 μg protein ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of GST-tagged effector proteins and 2 μl of FluoroTect™ GreenLys tRNA (Promega, USA) were gently mixed with High-Yield Wheat Germ Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... 1–2 μg of each RNA was treated with RNase-free Dnase I (Promega, Madison WI, USA) and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa) ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were treated with the CellTiter-Glo 2.0 Viability Assay (1:2 v/v; Promega, Madison, WI) using the Viaflo Assist Pipetting Platform (Integra Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... at a protein:Lys-C ratio of 100:1 (w/w) for 4 h at 37°C followed by trypsin (Promega) digestion at a ratio of 50:1 (w/w ...
-
bioRxiv - Cancer Biology 2022Quote: The 4T1-mScarlet and 67NR-GFP cell lines were generated by transfection using a 1:4 ratio of plasmid DNA:FugeneHD reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tryptic digests were performed overnight after addition of 46 μl of 100 mM Hepes pH 7.6 and 4 μl of 1 μg/μl Trypsin Gold (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... at room temperature (r.t.) for 4 hours and then further digested overnight with 1:50 (w/w) trypsin (Promega) at r.t ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL of 1:100 (diluted in phenyl red-free DMEM with 4% FBS) Nano-Glo substrate (Promega N1572) was added in each well ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Biochemistry 2023Quote: BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500 bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10μM amino acids (Promega), 0.21mM spermidine ...
-
bioRxiv - Cell Biology 2019Quote: ... diluted 1/500 in PBS-BSA 1% and 0.4 U.mL-1 RNAsin (Promega). We visualized and quantified 5-FUrd incorporation by using high content imaging device (OPERETTA ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells were transfected in a 6-well plate with 1 μg ADGRG6 DNA and 3 μL transfection reagent Fugene 6 (Promega, PRE2693) at 60-70% confluency and incubated for 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were digested with 0.5 µg of lysyl endopeptidase (Wako) at room temperature for 4 hours and were further digested overnight with 1 µg trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were incubated at 37°C for 1 hour and then proteolytic digestion was performed with LysC (Wako) for 4 hours and trypsin (Promega) overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-m6A conjugated beads were incubated with purified mRNA with rotation at 4°C overnight in 300 µL MeRIP buffer with 1 µL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...
-
bioRxiv - Microbiology 2019Quote: ... Cross-links of input and IP material were reversed by adding 10 μl 5 M NaCl and 4 μl 10 mg ml−1 Proteinase K (Promega), and incubated for 4 hours at 65°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Washed beads were re- suspended in 150 µl digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... lysyl endopeptidase (Wako) at room temperature for 4 hrs and were further digested overnight with 1:50 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... Protein digestion was performed using 1:100 (w/w) LysC (Wako Chemicals) for 4 h at 37°C and then finalised with 1:50 (w/w) trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The transfected cells were then treated with Aβ42 (1-4 μM) or calcitriol (100 nM) for 6 h before luciferase activity assay (Dual-Luciferase Reporter Assay, Promega). A 587-bp region of the human Cyp24a1 gene promoter that contains two VDRE motifs was cloned into the promoter-less luciferase expression vector pGL3-basic (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... the washed beads were re-suspended in 150 µl trypsin digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies used for western blotting were: anti-HALO (1:1000 in 0.5% milk TBST, 4°C o/n, Promega G9211), anti-GAPDH (1:10000 in TBST ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20,000 to 50,000 cells were lysed in the transposase reaction mix (12.5 μl 2xTD buffer, 2 μl TDE1 [Illumina], 10.25 μl nuclease-free water, and 0.25 μl 1% digitonin [Promega]) for 30 min at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... benthamiana leaves were collected at 2 dpi sprayed with a solution of 1 mM D–luciferin (Promega, E1603) and 0.02% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... A 1:1 dilution of Steady Glo (Promega) and Lysis Buffer were added to the cells and incubated at RT for 15 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-1-gal (1:1000, Promega Z378B), mouse anti-1-gal (1:1000 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... 1 mM CaCl2 with 1 µg trypsin (Promega). Digested proteins were acidified with TFA to pH < 2 and RapiGest SF was precipitated out ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Microbiology 2019Quote: ... The next day they were transfected over 24 hours with a DNA-Fugene HD mixture at a ratio of 1 μg DNA to 3 μl Fugene (Promega, Southampton, UK) according to the manufacturer’s instructions (Western analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...