Labshake search
Citations for Promega :
401 - 450 of 5128 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... either 2 µg pGL4.47[luc2P/SIE/Hygro] (Promega) or pGL4.52[luc2P/STAT5RE/Hygro] (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2) pRL Renilla luciferase control reporter (Promega, E2241) and 3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pGL4.10 (Luc.2; E665A) was purchased from Promega. The pGL4.10-ITGB1 reporter and a control Renilla luciferase vector were co-transfected into breast cancer cell lines using Lipofectamine 3000 transfection kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... plus 2 uL of random primers (Promega, C1181). This was then incubated at 70 °C for 10 mins ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 µl of 5x MTase-Glo Reagent (Promega) was added to wells ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used CellTiter Glo 2 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and incubated in RPMI1640 culture medium over 4 days at 37 °C and 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of 100 bp DNA Ladder (Promega) was added to confirm amplicons size and run at 100 V for 45 mins ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with 2 μg trypsin (Promega, v511c), shaking overnight at 700 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the CellTiter-Blue assay (G8081/2, Promega) following the protocol of the manufacturer using an EnVision multimode plate reader (PerkinElmer) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2 µL of sequencing grade modified trypsin (Promega) at a concentration of 0.1 µg/μL and 23 µL of 50mM ammonium bicarbonate/0.01% ProteaseMax were added ...
-
bioRxiv - Biochemistry 2023Quote: Cell viability assays using CellTiter-Glo 2 (Promega) were performed according to the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 U/μl of RNasin Ribonuclease Inhibitor (Promega)) for 20 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µM dNTPs and MMLV reverse transcriptase (Promega). Primer extension reactions to analyze initiation from the +1 and +3 sites of the le promoter were subjected to electrophoresis in 6% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µL ROX (CRX reference dye, Promega, C5411) were added to 1 mL SybrGreen as a passive reference dye that allows fluorescent normalization for qPCR data ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µL ROX (CRX reference dye, Promega, C5411) were added to 1 mL SybrGreen as a passive reference dye that allows fluorescent normalization for qPCR data ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µL ROX (CRX reference dye, Promega, C5411) were added to 1 mL SybrGreen as a passive reference dye that allows fluorescent normalization for qPCR data ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 µg of sequencing grade modified trypsin (Promega) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg/ml of herring sperm DNA (Promega) in dilution solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... the dual luciferase reporter psiCHECK-2 vector (Promega) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2 EDTA-free Protease inhibitor tablet (PROMEGA)) via probe sonication (10s ON/ 10s OFF at 60% amplitude ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl, 1 mM MgCl2, 2 mM EDTA, 1% NP-40, 1 mM DTT, 100 U/mL RNasin [Promega], 1X protease inhibitor) at 7 dpi ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were digested with 0.5 µg of lysyl endopeptidase (Wako) at room temperature for 4 hours and were further digested overnight with 1 µg trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were incubated at 37°C for 1 hour and then proteolytic digestion was performed with LysC (Wako) for 4 hours and trypsin (Promega) overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Washed beads were re- suspended in 150 µl digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... lysyl endopeptidase (Wako) at room temperature for 4 hrs and were further digested overnight with 1:50 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... Protein digestion was performed using 1:100 (w/w) LysC (Wako Chemicals) for 4 h at 37°C and then finalised with 1:50 (w/w) trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... the washed beads were re-suspended in 150 µl trypsin digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies used for western blotting were: anti-HALO (1:1000 in 0.5% milk TBST, 4°C o/n, Promega G9211), anti-GAPDH (1:10000 in TBST ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with the following primary antibodies diluted in TBS-T overnight at 4°C: mouse anti-HaloTag (1:5,000; Promega, G9211), mouse anti-Flag M2 (1:2000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transduced with the shRNA lentiviruses and selected on puromycin for 4 days before lysis in 1× passive lysis buffer (E1941, Promega) and dual luciferase readout using the Dual-Glo® Luciferase Assay System (E2940 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were then incubated overnight at 4°C with primary antibodies (mouse anti-LgBIT antibody at 1:750 dilution [Promega N7100] ...
-
bioRxiv - Biochemistry 2020Quote: ... Digestion solutions were brought to a final concentration of 2 M urea and 2 mM CaCl2 and a second digestion was performed overnight at 37 °C using trypsin (Promega, v5280) at 1:100 w/w ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein material was reduced with tris(2-carboxyethyl) phosphine (TCEP; 10 mM final) and digested overnight with 2 μg sequence-grade modified trypsin Gold (Promega, V5280) in 50 mM ammonium bicarbonate (NH4HCO3 ...
-
bioRxiv - Microbiology 2021Quote: ... rSARS-CoV-2/Δ7a-Nluc or rSARS-CoV-2/Nluc-2A infected cells was quantified using Nano-Glo® Luciferase Assay System (Promega) following the manufacturers’ specification.
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transfected with 1 – 2 μg EphA2-mTurquoise plasmid DNA using FuGene HD (Promega, #E2311) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 1–2 μg of each RNA was treated with RNase-free Dnase I (Promega, Madison WI, USA) and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa) ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were treated with the CellTiter-Glo 2.0 Viability Assay (1:2 v/v; Promega, Madison, WI) using the Viaflo Assist Pipetting Platform (Integra Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of GST-tagged effector proteins and 2 μl of FluoroTect™ GreenLys tRNA (Promega, USA) were gently mixed with High-Yield Wheat Germ Master Mix ...
-
bioRxiv - Biochemistry 2022Quote: ... urea was diluted to 1 M by adding 50 mM ammonium bicarbonate and 2 μg Trypsin (Promega) per 100 μg protein ...
-
bioRxiv - Microbiology 2023Quote: The assay was adapted from 15 where Hyp1-Nluc schizonts at 1% hematocrit and 1-2% parasitaemia were lysed in 1x NanoGlo buffer (Promega, USA) within a 96-well flat-bottom plate and parasite lysates were added to compounds and incubated for 10 minutes at 37°C ...
-
bioRxiv - Physiology 2024Quote: ... further steps were performed according to the manufacturer’s protocol using proteases trypsin and Lys-C (2 h at 47° C, 1:15 and 1:30, respectively, Promega, USA). Peptides (20 μg ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ml ice-cold wash buffer 1 (1x PBS with 2 % BSA, 1 mM DTT and 0.5 U/µl RNasin® Plus Ribonuclease Inhibitor - Promega #N2615) was added and cells were spun at 500 g for 3 min at 4 C ...
-
bioRxiv - Physiology 2024Quote: ... and hydrolyzed into the S-Trap column using trypsin and Lys-C (2 h at 47 °C, 1:15 and 1:30, respectively, all Promega, USA) in 40 μl 50 mM triethylammonium bicarbonate according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... cDNA were synthesized from RNA (4 μg) using AMV Reverse Transcriptase (Promega). ...