Labshake search
Citations for Promega :
4001 - 4050 of 6175 citations for Mouse Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Sequences of all plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Cat# 063001) with a Spectrum Compact CE System (Promega). The psPAX2-IN/HiBiT plasmid was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2022Quote: pSK-E2-nLuc replicon plasmid was linearised with BglII and pUC-HEV83-2 replicon plasmid was linearised with HindIII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: Monitoring cell viability in real time was performed by the RealTime-Glo MT Cell viability assay kit (Promega, G9713) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Amount of ATP release in response to compound were measured by Celltiter-Glo 2.0 cell viability assay kit (Promega) as per the manufactures’ protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega). All experiments were performed in biological triplicates.
-
bioRxiv - Biochemistry 2023Quote: ... Luminescence values were normalized by amount of live cells in vehicle control-treated wells (CellTiter-Glo 2.0 Assay Kit, Promega). CTG reagent was added to vehicle control-treated wells in triplicate 15 min after addition of the cAMP-glo Max Assay kit ONE buffer.
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... The number of viable cells was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega G3580) and absorbance at 490 nm was measured by a plate reader (CLARIOstar ...
-
bioRxiv - Genomics 2023Quote: ... Protocol for cell lysis and measurement of the activities of the firefly luciferase (Dual-Luciferase Reporter Assay kit, Promega), with normalisation using the Renilla luciferase activity ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were collected for a luciferase activity assay using a dual-luciferase assay kit (Promega, Madison, WI, USA). The normalized luciferase activity was obtained by using the formula ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was extracted using the Maxwell® RSC instrument together with the Maxwell® simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions with a final elution volume of 60 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... lactate dehydrogenase (LDH) release assay was performed using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, Madison, Wisconsin, USA) according to manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... All mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B).
-
bioRxiv - Developmental Biology 2023Quote: ... Ghost Database KY21.Chr1.1715) we extracted genomic DNA from local Norwegian animals using the Wizard Genomic DNA Purification Kit (A1120, Promega). We then used the purified gDNA at a concentration of 100-150ng/μl ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed on the plate and incubated with luminescence glo regents per the luminescence glo assay kit’s instructions (Promega). Luminescence was recorded using a BioTek Synergy2 plate reader.
-
bioRxiv - Cell Biology 2023Quote: DNA was prepared from bacterial cultures grown at 37°C using a Midiprep kit (PureYield Plasmid Midiprep System, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The intracellular NAD+ in 3T3-L1 cells or ASCs was measured using the NAD+/NADH-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 ng of total RNA was transcribed to cDNA using the ImProm-II™ reverse transcription kit (Promega, A3500) with random primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Renilla and Firefly luciferase activities were measured on a luminometer using the Promega dual luciferase kit (Promega, E1910) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega) at 24 ...
-
bioRxiv - Genetics 2023Quote: ... RNA (1000 ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript RT kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Genomics 2023Quote: ... Protein was precipitated by the addition of 200 μl Protein Precipitation Solution (Promega Wizard HMW DNA Extraction Kit A2920). Using a wide bore tip the samples were mixed by drawing up contents from the bottom of the tube and then expelled on the side of the tube 5 times ...
-
bioRxiv - Genomics 2023Quote: ... The total cellular DNAs of the activated CD4+ T cells were isolated using a DNA extraction kit (Promega Wizard) for analysis.
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was isolated from overnight cultures of Ag1 and Ag2 using the Genome Wizard kit (Promega, WI), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cells were collected to measure the firefly luciferase and renilla luciferase luminescent activities using the Dual-Luciferase Reporter Assay kit (Catalog:E1910, Promega) with 96-well plates (Nunc MaxiSorp ...
-
bioRxiv - Microbiology 2023Quote: ... The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega). To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Plant Biology 2024Quote: ... The complete amount of RNA was reverse transcribed to cDNA using the oligodT from the GeneRacer kit and following the manufacture’s guide of ImProm-II Reverse Transcriptase (Promega). The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cell survival was measured three days later using CellTiter-Glo luminescent cell viability assay kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All amplicons were then verified by gel electrophoresis and purified using a Wizard Gel Purification kit (Promega, Madison, WI).
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: NAD+ and NADH measurements were done with the NAD/NADH-Glo Assay Kit (#G9071 from Promega, Madison, WI, USA). Cells were grown in 24-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 25 µl of CellTiter-Glo® reagent from CellTiter-Glo® luminescent cell viability assay kit (Promega, Southampton, UK) was added to each well and mixed for 2 minutes on a plate shaker and incubated at room temperature (RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1-2 μg) was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Bioengineering 2024Quote: ... The hDF metabolic activity was measured with the CellTiter 96 ® Aqueous MTS Kit (Promega Corp., Madison, WI, USA). At each timepoint ...
-
bioRxiv - Cancer Biology 2023Quote: Total GSH levels in cells were detected by using luminescence-based GSHGlo Assay reagent kit (Promega, catalogue no. B6912) as instructed by the manufacturer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Females from each progeny were then pooled to perform genomic DNA extraction (Wizard® Genomic DNA Purification Kit, Promega) and subsequently do amplicon sequencing on the dsx target to check the frequency of the dsxFΔ11 allele in the offspring ...
-
bioRxiv - Microbiology 2024Quote: The oxidized glutathione (GSSG) and reduced glutathione (GSH) were individually measured by employing the Glutathione Assay Kit (Promega, USA) as described by Nakagawa et al ...
-
bioRxiv - Cell Biology 2024Quote: ... we isolated individual clones and screened for expression using the C-terminal nanoluc fusion (Nanoluc Lytic Detection Kit, Promega), followed by additional characterization of SMO agonist-induced ciliary accumulation via microscopy ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The plasmid DNA was purified from 4-mL overnight cultures by use of the Wizard Plus MiniPrep kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The ground material was used for genomic DNA extraction with the RSC Plant DNA Kit (Promega, Madison, WI, USA) using the Maxwell® RSC device according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ATP levels in conditioned media and serum were measured by RealTime-Glo Extracellular ATP Assay kit (Promega, Madison, WI).
-
bioRxiv - Cell Biology 2024Quote: ... and equal amounts of RNA per sample were transcribed into cDNA using the GoScriptTM Reverse Transcription Kit (Promega #A5000). Quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... tumoral area was macrodissected prior DNA extraction using Maxwell 16 FFPE LEV DNA Purification Kit (Promega, Madison, WI, USA). DNA from the 60 non-CCHD carotid bodies were previously extracted and passed internal quality control at the VHIO’s laboratory before sequencing ...