Labshake search
Citations for Promega :
351 - 400 of 4575 citations for Mouse Caspase 2 CASP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-HaloTag (Promega, G9211); rabbit anti-CIMPR (made in house) ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-Tag (Promega, G9211, mouse), and HSP90 (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2024Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Physiology 2019Quote: ... The wounded area and its surrounding area (2 x 2 cm) were immediately dissected out and RNA extraction was conducted using Maxwell® RSC simplyRNA Tissue Kit (AS1340, Promega, Madison WI) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... α-mouse IgG HRP conjugate (Promega W4021) were used as secondary antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-βIII-tubulin (G712A; Promega), rabbit anti-Cdc42 (07-1466 ...
-
bioRxiv - Plant Biology 2020Quote: ... a rabbit-anti-mouse-IgG (Promega) coupled with an alkaline phosphatase was used.
-
bioRxiv - Cancer Biology 2021Quote: ... Lumit anti-mouse antibody-LgBiT (Promega) and Lumit anti-rabbit antibody-SmBiT (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-ßIII tubulin (Promega, G7121); mouse anti-NDUFA9 (abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-LacZ (1/1000; Promega), mouse anti-βPS (1/10 ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-β-galactosidase (Promega, Z378B) 1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... goat α-mouse IgG antibodies (Promega) and donkey α-goat IgG (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-Lacz (1:200)(Promega), rabbit anti-CD4 (1:250)(Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... goat α-mouse IgG antibodies (Promega) and donkey α-goat IgG (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-mouse IgG HRP conjugate (Promega) anti-rabbit rhodamine–conjugated tubulin (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... anti-Halo (1:1000, mouse, Promega), anti-Myc (1:100 ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-mouse IgG HRP conjugate (Promega, catalog no ...
-
bioRxiv - Microbiology 2023Quote: ... goat α-mouse IgG antibodies (Promega) and donkey α-goat IgG (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti-Halo (Promega, G9211), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...