Labshake search
Citations for Promega :
351 - 400 of 891 citations for IL 5 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and Sp-EVs towards human endothelial cells was accessed by the CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein was digested for overnight with 5 ng/µL trypsin (Promega Corporation) in 50 mM ammonium bicarbonate at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 30° C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 37° C 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 hr after stimulation using Nano-Glo® Luciferase Assay System (Promega). For each time point 200,000 cells were tested in triplicate for each cell line.
-
bioRxiv - Bioengineering 2021Quote: ... or PG48 at 5% molar ratio were incubated with trypsin gold protease (Promega) at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Each 5 μL fraction sample was treated with DNase I (cat #M6101, Promega) for 1 h at 37°C and then diluted 1:20 in 50 μg/mL yeast tRNA (cat #Am7119 ...
-
bioRxiv - Microbiology 2021Quote: ... the HIV 5′-UTR (nucleotides 1–497) was cloned into pSP72 vector (Promega) using BglII and EcoRI sites under the control of T7 promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then digested with 5 μg of trypsin (Promega, Sequence Grade). After an ON incubation at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µg of total RNA were treated with RQ1 RNase-free DNAse (Promega) for 2h at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
bioRxiv - Microbiology 2020Quote: ... and T7 RNA polymerase as well as 5 μL RNasin RNase inhibitor (Promega). Transcription reactions were left overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 5 μL of 2x SYBR Green mastermix (Promega, Benelux BV), 2.5 μL primer mix (forward and reverse ...
-
bioRxiv - Biochemistry 2022Quote: ... and impregnated with 75 µL of 5 ng/µL trypsin (trypsin gold; Promega) solution overnight at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 175 μg/ml 5-bromo-4-chloro-3- indolyl-phosphate (BCIP) (Promega). Reactions were stopped as the signal became apparent with three PBS rinses ...
-
bioRxiv - Cancer Biology 2023Quote: ... Livers were incubated using Luciferase Cell Culture Lysis 5 x Reagent (Promega, E1531) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A total of 5 μL per well of 20x-NanoBRET Tracer K10 (Promega) at 10 μM for CSNK2A1 or 5 μM for CSNK2A2 in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were directly spiked with 5 pg of unmethylated lambda phage DNA (Promega) and subjected to bisulfite treatment and library construction using the post-bisulfite adaptor tagging (PBAT ...
-
bioRxiv - Cell Biology 2024Quote: ... RNAs were incubated with [5’-32P] pCp and T4 RNA ligase (Promega, M1051) O/N at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Microbiology 2023Quote: ... were digested with a modified MS grade trypsin (Promega; 1:5 enzyme/protein) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 5 µL per well of 20x-NanoBRET Tracer K10 (Promega) at 5 µM in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...