Labshake search
Citations for Promega :
351 - 400 of 1983 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Anti-mouse HRP conjugate (W4021, 1:10,000) and Anti-Rabbit HRP Conjugate (W4011, 1:10,000) were purchased from Promega (Madison, WI). Anti-COPI antibody was a gift from Charles Barlowe (Dartmouth Univ ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP Conjugate (W4011, 1:5000), and anti-Mouse IgG (H+L), HRP Conjugate (W4021, 1:5000) were purchased from Promega.
-
bioRxiv - Cell Biology 2020Quote: ... and anti-mouse HRP conjugate secondary (Promega W401B). Probing of Mcm2-7 using UM174 antibody was performed using 12% gels in order to compress signal from the six MCMs into a compact region to facilitate quantification ...
-
bioRxiv - Neuroscience 2020Quote: ... while horseradish peroxidase (HRP)-conjugated anti-rabbit (Promega), Alexa Fluor 555 goat anti-rabbit (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and an Anti-Mouse HRP Conjugate (Promega, W4021). Luminescence was imaged on a Licor Odyssey FC.
-
bioRxiv - Microbiology 2021Quote: ... Anti-rabbit IgG (H+L) HRP Conjugate (Promega) was used as the secondary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:2000 HRP-conjugated anti-mouse IgG (Promega) secondary antibody was applied for two hours at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-mouse IgG HRP (Promega, WB 1:10000) and anti-rabbit IgG HRP (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... HRP-conjugated anti-mouse IgG (Promega, Madison, WI), and ImmuonStar Zeta substrate (FUJIFILM Wako Pure Chemical Corporation ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP Conjugate (Promega, 1:10000 in Blocking one), was added to the membrane ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-mouse IgG HRP (Promega, WB 1:10,000), and anti-rabbit IgG HRP (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-mouse HRP conjugate secondary (Promega W402B), and GFP was probed with the monoclonal JL8 antibody (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... incubated in anti-rabbit-HRP (1:5000, Promega) and washed in 3x 10min PBS Tween 0.5% before detection ...
-
bioRxiv - Microbiology 2024Quote: ... and anti-mouse IgG HRP conjugate (Promega, W4021) as the secondary antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-mouse-IgG-HRP (W402B, 1:8000, Promega); anti-mouse-IgM-HRP (SC2064 ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Rabbit IgG HRP (1:20,000 Promega W401B). Western blot quantification was done by using ImageStudioLite.
-
bioRxiv - Immunology 2024Quote: ... Anti-Mouse IgG HRP (1:20,000 Promega W402B), Anti-Rabbit IgG HRP (1:20,000 Promega W401B) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and anti-mouse-HRP 1:10000 (S3721, Promega). The guinea-pig anti-MCTS1 antibodies (used at 1:500 ...
-
bioRxiv - Genetics 2024Quote: ... total RNA was isolated from the transfected cells using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA and reverse transcription was performed using the GoScript™ Reverse Transcription System (Promega, Madison, MI, USA). PCR amplification was performed using the pCAS2-RT-F and pCAS2-RT-R primers ...
-
bioRxiv - Biophysics 2022Quote: ... Blots were incubated with secondary antibodies for 1h at room-temperature (1:10000 in 5% skim-milk powder, anti-rb-HRP-conjugate (Promgea, W401B)/anti-ms-HRP-conjugate (Promega, W402B)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2022Quote: ... Reverse transcription was performed with M-MLV as described by Promega with OligodT 25 ng/μl or specific primers 0.04 μM final concentrations (Online Resource 3) ...
-
bioRxiv - Molecular Biology 2020Quote: ... We performed in vitro transcription/ translation using the TNT system (Promega) with pcDNA3 expression vectors for murine Flag-tagged Tet catalytic domains or full-length Halo-tagged human Tet proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... generated using the TNT T7 Quick Coupled Transcription/Translation System (Promega), was imported into isolated mitochondria for 20 min at RT and import was stopped by the addition of 0.5 μM valinomycin ...
-
bioRxiv - Developmental Biology 2022Quote: ... A reverse transcription reaction was performed using MMLV Reverse Transcriptase (Promega) or M-MuLV Reverse Transcriptase (Thermoscientific ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was then synthesized using the reverse transcription kit from Promega. Transcriptional levels of PD-L1 (Forward ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by cDNA synthesis using GoScript Reverse transcription mix (Promega, USA). SpCas9 expression was detected with primers chCas9_F1 (5’- GAGAGAATGAAGCGGATCGAAGAG - 3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed with an RT cDNA Synthesis Kit (Promega). Real-time PCR was performed with SYBR green SuperMix using an iCycler real-time PCR detection system (Bio-Rad).
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg RNA was reverse transcribed using Reverse Transcription Kit (Promega) with oligo(dT ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed using the AMV Reverse Transcription System (Promega), with a combination of oligo (dT ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the GoScriptTM Reverse Transcription System (Promega) and a C1000 Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was performed for one hour using random priming (Promega). qPCR reactions (0.5 μl cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... and underwent reverse transcription with ImProm-II Reverse transcriptase (Promega Corporation). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was synthesized using the reverse transcription system (Promega, Madison, USA) as described previously (Veeck et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized using the ImProm-II Reverse Transcription System (Promega). Gene expression master mix (Applied Biosystems 4369016 ...
-
bioRxiv - Molecular Biology 2020Quote: The coupled Transcription/Translation system (T7 Quick for PCR DNA, Promega) was used to express ATFS-1 from a PCR template ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcribed (RT) using the Reverse Transcription System kit (Promega). The resulting cDNA samples were amplified by TaqMan quantitative PCR using commercially available primer/probe kits from Applied Biosystems for BDNF (Gene Expression Assay Mm00432069_m1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and converted to cDNA using the Promega Reverse Transcription system (Promega). SYBR green qRT-PCR was performed in triplicate using cDNA and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Pathology 2022Quote: ... Reverse transcription PCR was performed using GoScript Super-Mix (Promega, USA), and RT-qPCR was performed using SYBR Green Super-Mix (Bimake ...
-
bioRxiv - Cell Biology 2020Quote: ... and reverse transcribed into cDNA using the Reverse Transcription System (Promega) according to the manufacturer‟s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the T7 TnT Quick coupled in vitro transcription/translation system (Promega) was used according to the suppliers instructions.
-
bioRxiv - Microbiology 2021Quote: ... purified RNA was reverse transcribed using the Reverse Transcription System (Promega) alongside parallel reactions without reverse transcriptase to exclude gDNA contamination ...
-
bioRxiv - Microbiology 2021Quote: ... and subsequently subjected to reverse transcription using AMV Reverse Transcripase (Promega) with a random 9-mer primer ...
-
bioRxiv - Physiology 2022Quote: ... Following reverse transcription with M-MLV Reverse Transcriptase (Promega, Madison, Wisconsin), qRT-PCR was performed using SYBR Green (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA using the Promega Reverse Transcription system (Promega). SYBR green RT-qPCR was performed in triplicate using cDNA and run on the Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA synthesis was done with the GoScript reverse transcription kit (Promega). Relative transcript levels were determined using SYBR Green PCR master mix on an ABI 7900HT machine ...