Labshake search
Citations for Promega :
3501 - 3550 of 6889 citations for Mouse Translational Activator Of Cytochrome C Oxidase 1 TACO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 1 µL RNasin® Ribonuclease Inhibitor (Promega Part # N211A), with 5 µl 5X First Strand Buffer (Invitrogen Catalog Number 18067017 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 µL of CellTiter-Fluor™ (Promega, Madison, Wisconsin) was added using a BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 µL of CellTiter-Fluor™ (Promega, Madison, Wisconsin) was added using a BioRAPTR FRD™ ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... Fractions were complemented using LgBiT (Promega, 1:200 dilution) and nanoluc substrate (Promega ...
-
bioRxiv - Systems Biology 2024Quote: ... Then 1 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... A 1:10 ratio (enzyme: protein) of Trypsin (Promega) and LysC (Wako ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of sequencing grade trypsin (Promega, Wisconsin, USA) was added and samples were incubated at 37 °C overnight.
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... containing trypsin (Promega; final 1/100 enzyme/protein ratio) and LysC (Wako ...
-
bioRxiv - Cell Biology 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Biochemistry 2024Quote: ... to reach 1% vol/vol as recommended by Promega, then mixed with YZ-01-A (final DMSO 1% vol/ vol ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM CaCl2 and sequencing grade trypsin (Promega, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Microbiology 2023Quote: ... and the addition of 1:1000 Nano-Glo (Promega). The bioluminescent signal was measured using a CLARIOstar luminometer (BMG Labtech ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of RNA treated with DNase (RQ1, Promega) was reverse-transcribed by Superscript III (Life Technologies) ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 unit of Taq polymerase (Promega, Madison, WI, USA), and approximately 75 ng of schistosome genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/µL Rnasin® Plus RNAse inhibitor (Promega), 2 mM DTT ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 μL of CellTiter Glo (Promega, diluted 1:6), was added to each well and luminescence was measured with an Envision plate reader ...
-
bioRxiv - Biochemistry 2023Quote: ... For trypsin digestion 1 μg of trypsin (V5111; Promega) was added ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg ml-1 Sequencing Grade Modified Trypsin (Promega). Peptides were eluted with 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and RNasin® Ribonuclease Inhibitor (#N2615, Promega; 1:1000)) ...
-
bioRxiv - Microbiology 2024Quote: ... leaves were sprayed with 1□mM luciferin (Promega, E1603) and 0.02 % (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was first extracted using the SV Total RNA Isolation kit (Promega, Beijing, China) before cDNA was synthesized using the PrimeScript RT reagent kit with gDNA Eraser (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was extracted and purified using the Wizard® Genomic DNA purification kit (Promega) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2020Quote: Measurement of NADPH ratio was performed using an NADP/NADPH-Glo™ assay kit (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from cells using the ReliaPrep™ tissue system kit (Promega; Z6012). cDNA was produced from 1 μg of RNA sample using M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from TA muscle with SV Total RNA isolation kit (Promega, Z3100) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was isolated using the Wizard Genomic DNA purification kit (Promega, Leiden, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples were extracted by Eastep® Super Total RNA Extraction Kit (Promega, Madison, WI) by following the suggested protocol within 24-36 hours after infiltration ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were harvested for quantification of cAMP activity using the cAMP-GLO Assay Kit (Promega). Percent increase in cAMP activity was calculated by the difference between control and treated groups ...
-
bioRxiv - Developmental Biology 2021Quote: ... Then RNA samples were reverse transcribed to cDNA by M-MLV reverse transcription kit (Promega). The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... and EGFP were synthesized using the RiboMAX Large Scale RNA Production System T7 kit (Promega). Approximately 100 μg of synthesized dsAntp was injected into the second chest spiracle at the first day of Bombyx larval wandering stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and quantitated using a Quantus fluoromoter with the QuantiFluor dsDNA kit (Promega, Madison, WI, USA). The isolates were identified using form-specific molecular markers and PCR conditions described in Poudel et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each quantitative RT-qPCR reaction was performed using the GoTaq qPCR Master Mix kit (Promega). For a 10 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Firefly and Renilla luciferase activities were determined by Dual-luciferase Reporter Assay kit (Promega, E1910). The STAT3 luciferase reporter plasmid was purchased from Affymetrix ...
-
bioRxiv - Immunology 2022Quote: ... vRNA was isolated from plasma using the Maxwell Viral Total Nucleic Acid Purification kit (Promega) on a Maxwell 48 RSC instrument (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... firefly and Renilla luciferase activities were determined by Dual-luciferase Reporter Assay kit (Promega, E1910). To evaluate NF-κB activity ...