Labshake search
Citations for Promega :
3501 - 3550 of 4685 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng of purified genomic DNA was spiked with 1 ng of unmethylated lambda DNA (Promega, Madison, WI, USA) and subjected to bisulfite treatment using the EZ DNA methylation gold kit (Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... centrifuged and resuspended in EZ lysis buffer, followed by three washes in wash/resuspension buffer (1x PBS, 1% BSA, 0.2U/μL RNase Inhibitor (Promega)) and labeled with propidium iodide (PI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times for 10 min in TBS-T and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10,000; Promega) in 5% non-fat dry milk -TBS-T for 1 h at room temp ...
-
bioRxiv - Genetics 2023Quote: ... samples were suspended in homogenization buffer (50mM Tris, pH7.5, 100mM KCl, 12mM MgCl2, 1%NP40-substititue, 1mM DTT, 200U/mL Promega RNasin ...
-
bioRxiv - Microbiology 2023Quote: ... and 400-800 ng of end repaired gDNA using a 1:20 dCTP:ddCTP mixture (9.5 mM dCTP Millipore Sigma #3732738001, 0.5 mM ddCTP Promega #U1225) to generate ∼20 bp C-tails.
-
bioRxiv - Immunology 2023Quote: ... and digested for 4 hrs with 2 mg/ml LysC (Wako Chemicals GmbH) in a ratio of 1:50 and O/N with 0.1 µg/µl trypsin (Promega) in a ratio of 1:50 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 1 ug of RNA and RT-qPCR reactions were performed using GoTaq® qPCR Master Mix (A6002 - Promega). Analyses were carried out in the QuantStudio™ 5 Real-Time PCR System ...
-
bioRxiv - Molecular Biology 2023Quote: ... The milk solution was removed and the membrane was incubated with a 1:1,000 dilution of streptavidin-alkaline phosphatase antibody (Promega) in TBS-T for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were proteolysed for 2 h at room temperature using 0.5 μg Lys-C (Wako) and subsequently for 16 h at 37 °C using 1 μg trypsin (Promega). Peptides were collected by centrifugation and acidified with 0.5 % trifluoroacetic acid.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were initially digested for 1 hour at 47°C with sequencing grade trypsin (Promega, San Luis Obispo, CA) dissolved in 50 mM TEAB (pH 7 ...
-
bioRxiv - Biophysics 2023Quote: ... In the first round of selection 400 nM of Xl-HAS-1-loaded nanodiscs diluted in the selection buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% BSA) was immobilized on streptavidin paramagnetic beads (Promega). Beads were washed three times in the selection buffer ...
-
bioRxiv - Immunology 2023Quote: ... the cells plus supernatants were combined with an equal volume of the respective caspase-Glo reagent for 1 h according to the manufacturer’s instructions (Promega). The mixture was then transferred to a Lumitrac 600 plate and luminescence was measured using a SpectraMax i3 instrument and the SoftMax Pro 6.3 Software (Molecular Devices) ...
-
bioRxiv - Developmental Biology 2023Quote: Digoxigenin-labelled antisense riboprobes were synthesized from cloned cDNA fragments (Supplementary file 1) using T7 or SP6 polymerases (Promega) and digoxigenin-labelled dUTPs (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... urea was diluted to 1 M and proteins digested overnight with modified sequencing grade trypsin (Promega, Madison, WI, USA) at a 1:50 enzyme:protein ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.05% (v/v) NP-40 and 0.5% (v/v) Triton X-100) containing 20 U ml−1 of RNasin (Promega), 1 mM DTT ...
-
bioRxiv - Microbiology 2023Quote: ... in TBS-T followed by a washing step for 30 min with TBS-T and a final 60 min incubation with with 1:10.000 horseradish peroxide-conjugated anti-rabbit IgG (Promega) in TBS-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 ng pCas9 mCherry Frame +1 and 100ng pCRISPaint HaloTag-Puro donor plasmids were transfected using ViaFect (Promega E498A). Three days post-transfection cells were sub-cultured into media supplemented with puromycin (0.8 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... Trypsin digestion was performed using a trypsin solution with a concentration of 1 μg /μL (Trypsin Gold, V528A, Promega), and 0.6 μL of the trypsin solution was added to achieve a final ratio of 1:50 ...
-
bioRxiv - Biochemistry 2023Quote: Cells stably expressing epitope-tagged NK1R were transiently transfected (Lipofectamine™ 3000 Transfection Reagent) with 1 μg of pGL4.29[luc2P/CRE/Hygro] or pGL4.30[luc2P/NFAT-RE/Hygro] plasmids (Promega Corp.), seeded in a white-walled 96-well flat clear bottom plate (Corning #3610) ...
-
bioRxiv - Immunology 2023Quote: ... RH5ΔNC-specific B cells were identified as live CD19+ IgG+ RH5ΔNC-APC+ RH5ΔNC-PE+ cells and single cell sorted into 96-well plates containing 10µL/well lysis buffer (10mM Tris [T3038, Merck], 1 unit/mL RNasin Ribonuclease Inhibitor [N2515, Promega]) and frozen at -80 °C.
-
bioRxiv - Molecular Biology 2023Quote: ... protoplasts were transferred onto BCD-growth medium containing ammonium tartrate and geneticin G418 antibiotic (50 µg ml−1; Promega) followed by two weeks growth period without the antibiotic and second selection period for two weeks with antibiotic again.
-
bioRxiv - Molecular Biology 2023Quote: RNA samples from two biological replicates were pooled and total RNA was treated with DNase (1 U/µl, Promega). For cDNA synthesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing the promoter region of spia-1 (1.23 kb upstream from the start ATG) and the entire genomic region into the pGEMT vector (Promega). A transcriptional construct (pSO22) ...
-
bioRxiv - Plant Biology 2024Quote: ... The alkylation was stopped by the addition of 1 µl of 200 mM cysteine and the samples digested overnight with 1 µl of 0.5 µg/μl trypsin (MS Gold, Promega). The resulting peptides were desalted and subsequently analysed on UltiMate™ 3000 RSLCnano System connected to LTQ Orbitrap Velos mass spectrometer (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Cell Biology 2024Quote: ... reduced (6.5mM DTT, 1 hour at 60°C), alkylated (54mM Iodoacetamide, 30min, RT) and digested with 1µg of Trypsin (Promega) (96) ...
-
bioRxiv - Genetics 2024Quote: ... YFP-negative first instar larvae of the progeny of gwnull- 1/PBac(681.P.FSVS-1)PMCACPTI001995 or gwnul1-2/PBac(681.P.FSVS-1)PMCACPTI001995 were collected 38 hr after egg laying and were lysed in Passive lysis buffer (Promega). After centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... At 8 and 24 hpt monolayers were lysed with 100 μl 1 x passive lysis buffer according to the manufacturer’s instructions (Promega), stored at −80°C and analysed using Dual-luciferase substrate (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were stained with 1 nM Halo Tag Ligand (HTL) tagged with Janelia Fluor 646 (HTL-JF646, Promega, #GA1110) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The sample was processed according to the SP3 protocol36 and digested overnight with trypsin (Promega, enzyme/protein 1:50). Peptides were desalted using SBD-RPS tips as previously described37 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic cell count was measured as described above using the Caspase-Glo® 3/7 3D Assay (Promega). Bliss synergy scores were calculated using the SynergyFinder web application (version 3.0)61.
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...