Labshake search
Citations for Promega :
3451 - 3500 of 3876 citations for Urea Nitrogen Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... from 25 randomly selected CM samples was extracted by an automated Maxwell 16 DNA extraction platform using blood DNA purification kits (Promega, UK) following previously described protocols2 ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was isolated from homogenized tissues using the Maxwell 48 RSC Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from 10 flies for each experiment condition and the process followed the protocol of Promega ReliaPrepTM RNA Tissue Miniprep System kit (Promega, Z6110). Extracted RNA was stored in a −70°C refrigerator ...
-
bioRxiv - Molecular Biology 2019Quote: ... a TUNEL assay was performed on some sections according to the protocol for the DeadEnd Fluorometric TUNEL Kit (Promega, Fitchburg, WI). Stained sections were imaged using fluorescent microscopy and TUNEL-positive cells in the outer-nuclear layer (ONL ...
-
bioRxiv - Molecular Biology 2021Quote: ... The release of lactate dehydrogenase (LDH) into the cell culture medium was quantified by bioluminescence using the LDH-Glo™ Cytotoxicity Assay kit (Promega). 10% Triton X-100 was added to untreated cells for 15 minutes to determine the maximum LDH release ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting 2.6-kb fragment was separated from the 1.4-kb fragment and uncut plasmid by agarose gel purification (Promega Gel Wizzard Kit). A set of oligonucleotides that form a biotinylated and primed fork was ligated to one end of the fragment and the final product purified on a Sepharose-4B column as previously described [42] ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 56 Fusobacterium isolates were recovered and subjected to DNA extraction using the Wizard genomic extraction kit (Promega, USA). For each isolate ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 g of fresh leaves were collected from each genotype and DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega, USA) following manufacturer instructions ...
-
bioRxiv - Plant Biology 2019Quote: Total of RNA was extracted from various tissue of plants by using the Eastep®Super Total RNA Extraction Kit (Promega). The cDNA was synthesized from Dnase I treated total RNA using M-MLV 1st Strand Kit (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2019Quote: Liquid cultures of the transformed cells were used for plasmid extraction and purification using the Wizard® Plus SV Minipreps DNA Purification System kit (Promega). The plasmids quality and concentration were quantified using the Synergy HTX plate reader (BioTek ...
-
bioRxiv - Microbiology 2019Quote: ... quantified with Qubit dsDNA HS Assay kit and cloned using the pGEM®-T Easy Vector Systems (Promega, Madison, Wisconsin, US). Plasmids were isolated using the NucleoSpin Plasmid kit (Macherey-Nagel ...
-
bioRxiv - Plant Biology 2020Quote: A luciferase-based kinase activity assay was performed according to the manufacturer’s instructions of ADP-Glo™ Kinase assay kit (Promega, Germany). 1nmol kinase (cytoplasmic domain ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCDNA-Cnot3 Δ701-751 and pCDNA-Cnot3Δ651-751 were in vitro transcribed/translated using a TNT® Quick Coupled Transcription/Translation kit (Promega, USA) according to manufacturer’s instructions using 10μCi of 35S-Methionine to radiolabel the proteins ...
-
bioRxiv - Genetics 2021Quote: ... of G1 and G2 mosquitoes fluorescently expressing the actin5c::eCFP construct was extracted as individual samples using the Wizard® Genomic DNA Purification Kit (Promega). Regions of gDNA were then amplified according to the three primer pairs as indicated in Fig ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 ul were used as templates for PCR with the srrm3 or srrm4 primers designed to amplify the genomic region of interest (listed in Table S12) and GoTaq® Flexi DNA Polymerase kit (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... liquid cultures were pelleted at 3000 g for 10 minutes and miniprepped using the Tecan Fluent robotic liquid handler with Promega Wizard SV 96 Plasmid DNA Purification Kit (Promega; A2250).
-
bioRxiv - Bioengineering 2020Quote: ... Cells were incubated with nanoparticles encapsulating Fluc mRNA and analyzed for cell viability and luciferase activity with the ONE-Glo™+Tox luciferase reporter and cell viability assay kit (Promega) using a multimode microplate reader.
-
bioRxiv - Immunology 2021Quote: Around 1×105 cells were treated as indicated prior to lysis and RNA isolation using the ReliaPrep™ RNA Miniprep kit (Promega). Approximately 1μg of total RNA was reverse transcribed into cDNA using SuperScript III (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... We detected the cytotoxicity by a lactate dehydrogenase (LDH) assay using the Cytotox 96 non-radioactive cytotoxicity assay kit (Promega, USA) according to the kit instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: miRNAs were isolated from ultracentifuged EVs resuspended in 25 ul of phosphate buffered saline (PBS) using the Maxwell® RSC miRNA Plasma and Serum Kit (AS1680, Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... The duplicate amplification products of each sample were pooled and purified with the SV Wizard PCR Purification kit (Promega, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The cytotoxicity of compounds on HEK293T and Vero cells was evaluated using the CytoTox-Glo™ Cytotoxicity Assay kit (Promega, #G9290), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... hLamp1-mCherry (this study) were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B), and diluted to 30–80ng/μl for injection into embryos ...
-
bioRxiv - Developmental Biology 2020Quote: ... The α-tub∷GFP (Chung et al., 2014) plasmid was injected at 5-10ng/μl after purification using the PureYield Midiprep kit (Promega, #A2492).
-
bioRxiv - Zoology 2021Quote: ... The PCR products were detected through 2% agarose gel electrophoresis and purified with an AxyPrep DNA gel recovery kit (Axygen Biosciences, Union City, CA, USA) and then quantified with a QuantiFluor(tm)-ST blue fluorescence quantitative system (Promega, USA). Purified amplicons were pooled in equimolar amounts ...
-
bioRxiv - Cell Biology 2021Quote: In vitro translated (IVT) proteins were generated in rabbit reticulocyte lysate using the SP6 TNT Quick-Coupled Transcription/Translation kit (Promega, L2080) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... PCR fragments amplified from genomic DNA extracted from the different founder mice using the Wizard SV genomic DNA extraction kit (Promega, A2360), were cloned into a vector using the TOPO TA cloning kit (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... was synthesized from 1 μg of total RNA, using oligo-dT primers (USB Corporation, Cleveland, USA) and a reverse transcriptase kit (ImPROm-II, Promega, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Intracellular glutamate was measured in chondrocytes in 96 well plate format utilizing Glutamate-Glo assay kit (J7021, Promega, Madison, WI USA). Luminescence was measured on microplate reader ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from lung tissue using the Maxwell automated instrument and the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega). The concentration of RNA and quality were measured with HS Total RNA 15nt.methods (Agilent ...
-
bioRxiv - Bioengineering 2022Quote: ... Media was collected and basal rate of glycerol release by the adipocytes was measured using a Glycerol Glo™ Assay kit (Promega) and luminescence was measured according to the manufacturer’s instructions using a plate reader ...
-
bioRxiv - Cancer Biology 2022Quote: ... GB02 and GB03 using the Maxwell® 16 Instrument with the Maxwell® 16 Tissue DNA Purification Kit (Promega, Madison, WI). DNA concentration was determined using the Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 1/6th of the diaphragm) using a Maxwell RSC Instrument and Maxwell RSC simplyRNA Tissue Kit (both Promega, Southampton, UK) and complementary DNA (cDNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The yeast colony was grown overnight in 10 ml of YPD and the gDNA was extracted using the Wizard Genomic DNA Isolation kit (Promega, Switzerland). The PCR reaction was as follows ...
-
bioRxiv - Molecular Biology 2022Quote: DNA extraction was also done for all the samples using the Wizard® Genomic DNA Purification Kit according to the manufacturer’s protocol (Cat#A1120, Promega USA).The eluted DNA was quantified by QuantusTM Fluorometer® (Cat# E6150 Promega Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were lysed and firefly and Renilla luminescence were measured following the manufacturer’s directions (Dual luciferase kit, Promega, Madison, WI) on a luminometer (GloMax® 20/20 Luminometer ...
-
bioRxiv - Genomics 2022Quote: ... The liquid cultures were centrifuged at 10,000 rpm and DNA was extracted from the pelleted cells using Wizard DNA purification kit (Promega, Madison, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 5 mL of overnight cultures using the Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) and DNA concentration was measured using a Qubit™ Fluorometer and Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Transduction efficiency was assessed by quantifying luciferase activity in cell lysates using a commercial kit (Luciferase Assay System, Promega, Cat. #E1500) and a plate-reading luminometer (SpectraMax i3x ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining ATP was readout after 3 h incubation using Kinase-Glo® Luminescent Kinase kit following manufacturer’s instructions (Promega, WI, USA).
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... and 100 μl sample volumes were assayed in triplicate for ATP content using the BacTiter-Glo bioluminescence kit (Promega, Mannheim, Germany). After 5 min incubation in the dark to allow for the decay of plate autofluorescence ...
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of 50 µl were analyzed in triplicate for NAD+ and NADH with the NAD/NADH-Glo Kit (Promega, Mannheim, Germany) in white 96-well plates using a Synergy HTX microplate reader ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of all the pOXA-48 bearing strains was isolated using the Wizard genomic DNA purification kit (Promega, WI, USA), and quantified using the QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from viral transport medium or directly from tracheal aspirates by Maxwell® RSC Blood DNA Kit per manufacturer’s instructions (Promega Corporation). RNase A was added to samples to remove potential viral RNA ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified by Quantus™ Fluorometer (Promega, USA). Purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina MiSeq PE300 platform (Illumina ...