Labshake search
Citations for Promega :
301 - 350 of 404 citations for Recombinant Human CEACAM1 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Standards for quantification were created by serial dilution of pre-quantified BSC human male DNA (Promega). Amplification reactions were performed in duplicate using 96 well-plates using a CFX96 Touch Real-time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: The region of interest (750-850 bp) was PCR amplified from pooled male human DNA (Promega) and cloned into a STARRseq luciferase validation vector_ORI_empty plasmid (Addgene plasmid #99298 ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Bioengineering 2020Quote: ... and detected with anti-rabbit or anti-human HRP-conjugated secondary antibodies (Promega W4011 and W4031). Blots were developed using ECL (ThermoScientific 32106 ...
-
bioRxiv - Immunology 2023Quote: ... 100 μl of 5,000-fold diluted Peroxidase AffiniPure goat anti-human IgG (H+L) antibody (Promega) was added into each well and incubated for 1 h at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega). All mutated plasmids were constructed from wild type plasmids by Fast Mutagenesis System (TransGen Biotech) ...
-
bioRxiv - Immunology 2024Quote: ... TNF-α (human; DuoSet; R&D) and relative LDH levels using a CytoTox 96 Kit (Promega). For THP-1 viability assays ...
-
bioRxiv - Microbiology 2024Quote: ... cultured CT DNA from two HUCH and one UBA sample was spiked into human DNA (Promega G1471 ...
-
bioRxiv - Cancer Biology 2021Quote: Each enhancer or promoter region was amplified from human genomic DNA and cloned into pGL4.10 [luc2] (Promega) containing a SNP (rs718960 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCMVΔ8.9 plasmids were co-introduced into human embryonic kidney 293T cells using the FuGENE reagent (Promega). 48 h after transfection ...
-
bioRxiv - Microbiology 2020Quote: ... albicans to damage human vascular endothelial cells was assessed by the CytoTox-96 assay (Promega, Madison, WI), which measures the release of lactate dehydrogenase (LDH ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells were transfected with human RXFP1 pcDNA-Zeo-tetO and the GloSensor reporter plasmid using FuGENE (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK 293T cells were co-transfected with human MOR and a luciferase-based cAMP biosensor (GloSensorTM, Promega). The next day ...
-
bioRxiv - Cell Biology 2024Quote: All human cell lines were authenticated at each batch freezing by STR profiling (StemElite ID System, Promega). All cell lines were tested for mycoplasma at each batch freezing by PCR (32 ...
-
bioRxiv - Genomics 2023Quote: ... Primer efficiency was calculated using a 10-fold serial dilution of Human Mixed Genomic DNA (Promega G3041). For primer sequences and calculated efficiencies ...
-
bioRxiv - Genetics 2022Quote: We performed transient transfection on human pluripotent stem cells using FuGENE® HD Transfection Reagent (Promega, E2311). The cells were splitted and treated with Y-27632 for one before transfection.
-
bioRxiv - Cancer Biology 2024Quote: ... After 24- (human) or 48-hours (ID8) H2O2 was measured using ROS-Glo H2O2 assay (Promega, G8820) according to manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with a control Flag or HA-GSK-3βWT human plasmid using Fugene 6 (Promega #E2693) in a 2:1 ratio and incubated for 3 hours in a CO2 incubator ...
-
bioRxiv - Cancer Biology 2020Quote: ... T47D cells and MCF7 cells were transfected with empty or human LIP-containing pcDNA3.1 via Fugene HD (Promega) using the manufactures protocol ...
-
bioRxiv - Cancer Biology 2021Quote: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MV4-11 (DSMZ Cat# ACC-102, RRID:CVCL_0064) human AML cell lines were identified by PCR-single-locus-technology (Promega, PowerPlex21 PCR Kit ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Neuroscience 2024Quote: ... human CaV1.3 cDNA (accession number NM_001128840.2) was de-novo synthesized and assembled into a HaloTag vector (Promega G7721) using restriction cloning ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Genomics 2022Quote: Approximately 500-bp regions of DNA containing rs80282103 and rs11154336 were amplified from purified human genomic DNA (Promega, #G1521) by PCR using engineered restriction sites to allow directional cloning into the multiple cloning region of the pGL4.23[luc2/minP] luciferase reporter vector (Promega ...
-
bioRxiv - Neuroscience 2021Quote: We constructed luciferase reporter plasmids by cloning an ∼900 bp region containing human 1b30 into the pGL4.24 vector (Promega) upstream of the minP ...
-
bioRxiv - Microbiology 2023Quote: ... and Sp-EVs towards human endothelial cells was accessed by the CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Cell Biology 2024Quote: ... they were transfected with either control plasmid or Flag-GSK-3α WT human plasmid using Fugene 6 (Promega, #E2693) at a 3:1 ratio (DNA:Fugene 6) ...
-
bioRxiv - Biophysics 2024Quote: Tracking was performed in Human Bronchial Epithelial Cells (HBEC) labeled with between 0.5 pM – 1 pM JF646 dye (Promega). At this concentration of dye ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.