Labshake search
Citations for Promega :
301 - 350 of 608 citations for PF 4 CXCL4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then resuspended in 4 ml DMEM/F12 + 80 μl DNase (1U/μl) (Promega M6101). The DNase solution was gently shaken by hand for 2–5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gel pieces were rehydrated in a mixture of 4 ng/µL trypsin (Promega, Madison, WI) and 0.01% ProteaseMAX (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by a 4 times dilution in Tris buffer and an overnight trypsin digestion (Promega) at a ratio 1/100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resuspended grindate was incubated (4°C, 20 min) with 660 U of DNase I (Promega). Insoluble cell debris was pelleted by spinning (16,000 g ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were then incubated overnight at 4 °C with anti-p75NTR (Promega; G323A; 1:300) and anti-TRADD (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were then incubated overnight at 4°C with either anti-β3-tubulin (Promega #G712A) or anti-Oct4 (Santa Cruz Biotechnologies #SC-5279 ...
-
bioRxiv - Cell Biology 2021Quote: ... Neurons were then incubated overnight at 4° C with anti-p75NTR (Promega; G323A; 1:500) and anti-TRAF6 (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C) and then resuspended in 100 µl 1 x Passive Lysis Buffer (PLB, Promega). 45 µl of the luciferase assay substrate dissolved in Luciferase Assay Buffer II was plated on a 96-well plate and 10 µl of the cell lysate was added immediately before measurement of Fluc activity using a Tecan reader ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were digested using 4 μg of trypsin (sequencing grade, low autolysis trypsin; Promega), at 37 °C for 16 h ...
-
bioRxiv - Genetics 2022Quote: ... cells were transfected with L1 reporter constructs using 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Compound treatment was initiated 1-4 hours before transfections with FuGENE HD transfection reagent (Promega) following the manual ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fisher) containing 4% FBS with or without HaloTag NanoBRET 618 Ligand (Cat. No. PRN1662, Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
HIVtat Alters Epithelial Differentiation State and Increases HPV16 Infectivity in Oral KeratinocytesbioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 hours incubation at 37 °C) and 5 μg of trypsin (Trypsin Gold from Promega, in 50 mM TEAB pH 8.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (4 μg) was reverse-transcribed using oligo-dT and the Reverse Transcription System (Promega). cDNA samples were diluted 1:10 and 5 μl of each sample were used for PCR reactions (final volume of 20 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...