Labshake search
Citations for Promega :
301 - 350 of 758 citations for Mouse Anti SARS Coronavirus Nucleoprotein Antibody 3863 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Dilutions of antibodies applied were: rabbit anti-ferritin 1:10000 (primary) and anti-rabbit HRP conjugated (Promega) 1:10000 (secondary).
-
bioRxiv - Molecular Biology 2020Quote: ... The membrane was probed with α-Halotag mouse monoclonal antibody (Promega, diluted 1:1000 in Blocking Buffer), washed 3 times in TBS-Tween ...
-
bioRxiv - Molecular Biology 2020Quote: ... then probed with goat α-mouse HRP-conjugated secondary antibody (Promega, diluted 1:10000 in Blocking Buffer) and finally washed 3 times in TBS-Tween ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-T-Cofilin 1:2000 (Bamburg lab, 1439 or Cell Signalling, 5175) and mouse anti-β3-tubulin 1:2000 (Promega, G7121) diluted in 1%BSA/PBS and incubated overnight at 4ºC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary HRP-conjugated antibodies were added at a dilution of 1:10,000 in 5% milk in TBST and incubated for 60 minutes at room temperature (Anti-Mouse: Promega #W402B; Anti-Rabbit: Promega #W401B). The Pierce SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Scientific #34577 ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti-Fat (kind gift from Helen McNeill) was used at 1:500 and mouse anti-β-galactosidase (Z3781, Promega; RRID:AB_430877) was used at 1:500 ...
-
bioRxiv - Genetics 2022Quote: ... membranes were washed and incubated with the appropriate HRP conjugated secondary antibody (1:3,000 anti-rabbit W401B antibody from Promega), and the reaction was finally visualized with the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2021Quote: ... and the SARS-CoV-2 spike protein (23) into HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). Spike sequences from the following global strains REF were used ...
-
bioRxiv - Microbiology 2022Quote: ... either with SARS-CoV-2 S and Jun or with ACE2 and Fos plus the pRL Renilla Luciferase (Promega) to normalize the signal ...
-
bioRxiv - Microbiology 2020Quote: ... Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega) and enhanced chemiluminescence reagents (Pierce ...
-
bioRxiv - Biochemistry 2022Quote: ... membrane was incubated with anti-HaloTag antibody (1:1000; Promega Corporation; G9281) and then with anti-Rabbit IgG Horseradish Peroxidase linked whole antibody (1:5000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibodies used were: anti-rabbit-IgG-HRP (W401B, 1:8000, Promega); anti-mouse-IgG-HRP (W402B ...
-
bioRxiv - Neuroscience 2021Quote: ... Neurite outgrowth was visualized by immunostaining with mouse anti-β III tubulin (1:1000; Promega) followed by incubation with Alexa 594-conjugated anti-mouse secondary antibodies (Invitrogen).
-
bioRxiv - Immunology 2023Quote: ... followed by goat anti-mouse immunoglobulin conjugated to alkaline phosphatase (Promega S3721, dilution 1:7500). Focuses of infection were revealed using NBT/BCIP reagent (Promega) ...
-
bioRxiv - Genetics 2019Quote: ... fixed with 4% paraformaldehyde and labeled with rabbit polyclonal anti-GFP (Minotech Biotechnology) and mouse anti-β-galactosidase (Promega Cat# Z3781, RRID:AB_430877) primary antibodies ...
-
bioRxiv - Plant Biology 2020Quote: ... The target proteins were immunodecorated with primary antibodies and then incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibodies (Catalogue number: W4011, Promega) at a dilution ratio of 1:20.000 ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Neuroscience 2022Quote: ... Protein bands were detected with horseradish peroxidase (HRP)-conjugated rabbit or mouse secondary antibody [1:1,000 dilution] (Promega). The chemiluminescence signal was imaged using an Odyssey XF Imager (LI-COR ...
-
bioRxiv - Microbiology 2020Quote: ... The 50% tissue culture infectious dose (TCID50) of SARS-CoV-2 pseudovirus was determined using the Steady-Glo luciferase assay system (Promega).
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... In vitro transcribed RNA derived from plasmid “pCI/SARS-CoV envelope” was synthesized using T7 RiboMAX Express Large Scale RNA production system (Promega), then purified by phenol/chloroform extractions and two successive precipitations with isopropanol and ethanol ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2022Quote: ... and a spike-expressing plasmid (pCAGGS-SARS-CoV-2-spike) were co-transfected into HEK293T cells using Fugene HD transfection reagentia (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with the primary antibodies (1D4 1:1500, Anti-Calnexin Sigma c4731 1:600, Anti-LgBiT Promega N7100 1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... all cells were incubated in the following: mouse anti-βIII tubulin (1:1000; 2 hr; Promega) and goat anti-mouse Alexa 546 (1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... were secondary incubated with anti-mouse IgG (H+L) horseradish peroxidase coupled (1:3,000, W402b, Promega) and polyclonal anti-rabbit IgG (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were then incubated with an alkaline phosphatase-conjugated anti-mouse IgG (Promega, Madison, WI, USA) as the secondary antibody ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein production was confirmed by western blot using an anti-HaloTag antibody (Promega). HaloTag-ligand conjugated magnetic beads (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... followed by a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Promega). Chemiluminescence signals were detected using the GE ImageQuant LAS4000 camera (GE Healthcare Life Sciences).
-
bioRxiv - Developmental Biology 2021Quote: The antibodies used were: Rabbit anti-pJNK pTPpY (1:500, Promega, Cat#V93B), Rat anti-Ci(1:1,000 ...
-
bioRxiv - Systems Biology 2023Quote: ... Horseradish peroxidase-conjugated secondary antibodies were purchased from Promega (anti-rabbit IgG, W4011). Membranes were stripped with 0.2 M NaOH as needed ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rabbit anti-Caspase-3 polyclonal antibody (1:250, Promega/Fisher, PR-G7481) overnight at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... incubated with the secondary antibody rabbit anti chicken IgY HRP [(Promega Corporation, G1351) 1:10000] for 2 h and again washed three times ...
-
bioRxiv - Microbiology 2023Quote: The potential for M2e-specific antibodies to induce ADCC was evaluated using a mouse FcγRIV ADCC Reporter kit (Promega). In brief ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Immunology 2021Quote: Pseudoviruses expressing complete SARS-CoV2 spike genes were prepared by transient transfection of HEK293T cells with three plasmids: SARS-CoV2 MLV-gag/pol and MLV-CMV-luciferase plasmids using Fugene 6 (Promega Inc.) as described earlier (Rogers et al. ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).