Labshake search
Citations for Promega :
301 - 350 of 5086 citations for Human Guanylate Binding Protein 6 GBP6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Mass Spec-Compatible Human Protein Extracts, Cat# V6951) and digested yeast protein extract (Mass Spec-Compatible Yeast Protein Extracts, Cat# V7461) were from Promega, commercial human plasma samples (Human Source Plasma ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins were purified by using MagneHis™ Protein Purification System (Promega, USA). The peptides of the transporters PDR6 ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion protein was purified using HisLink Protein purification resin (Promega (Madison, WI) #V8821 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Genomics 2021Quote: ... Tris(2-carboxyethyl)phosphine (TCEP) and BCA protein assay kit were from Pierce and sequence-grade trypsin was from Promega. Rapigest and Sep-Pak C18 columns were from Waters and C18 Zip tips were from Millipore ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcription factors were expressed using at least 2000 ng PCR product per sample with the TnT T7 Quick for PCR DNA in vitro protein expression kit (Promega). All reaction volumes were doubled to yield a total of 100 µL protein product per transcription factor ...
-
bioRxiv - Cell Biology 2024Quote: 35S-methionine-labelled prey proteins (Grip91, Sas4) were produced in vitro using the TnT T7 Quick Coupled IVTT kit (L1170, Promega). The detailed protocol of the GST-IVTT binding assay is described previously 52.
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 was detected by indirect sandwich amide chemiluminescence ELISA using a luminescence plate reader (GloMax Promega, USA). This total GLP-1 assay detects GLP-1 (7-36 ...
-
bioRxiv - Molecular Biology 2021Quote: ... A protein standard (Promega) was added to the non-tagged cells as a known reference of protein concentration to luminescence output ...
-
bioRxiv - Microbiology 2022Quote: ... Protein Precipitation Solution (Promega) was added to the lysate ...
-
bioRxiv - Molecular Biology 2020Quote: ... HaloTag Standard Protein (Promega) was labelled with 10 fold molar excess (5 µM ...
-
bioRxiv - Genetics 2023Quote: ... Protein Precipitation Solution (Promega) was added to the lysed mixture ...
-
bioRxiv - Microbiology 2023Quote: ... Protein precipitation solution (Promega) was added and samples were vigorously mixed ...
-
bioRxiv - Cancer Biology 2021Quote: Plasmids were transiently transfected into 293T17 cells using FuGENE 6 (Promega). For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Transfection of plasmids into cells were performed using FuGENE 6 (Promega) according to the manufacturer’s protocol and the cells were harvested 24 hours after transfection ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were transfected with EB3-GFP using FuGENE 6 (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2021Quote: ... All transfections were performed with FuGENE 6 transfection agent (Promega E2691) in Opti- MEM Reduced Serum Medium (Gibco 31985070 ...
-
bioRxiv - Biophysics 2020Quote: ... Transfection was performed using Fugene 6 transfection reagent (Promega, Madison, WI). When WT and mutant myc-KCNQ1 were co-transfected ...
-
bioRxiv - Cancer Biology 2021Quote: ... expression plasmids were delivered with Lipofectamine 3000 or FuGene 6 (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... a total 3μg of plasmid DNA and 6μL FuGENE 6 (Promega) were combined in 300μL Opti-MEM (Gibco) ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293 cells were co-transfected using Fugene 6 transfection reagent (Promega) with MAC-tag (600ng ...
-
bioRxiv - Microbiology 2020Quote: ... cells were treated with 6 μM EnduRen (Promega, Madison, WI, USA), a substrate for Renilla luciferase ...
-
bioRxiv - Biophysics 2021Quote: pGFP was transfected using FuGENE®6 Transfection Reagent (E2691,Promega) with OptiMEM (31985088 ...
-
bioRxiv - Immunology 2022Quote: ... Phoenix cells were transfected using FuGENE 6 Transfection Reagent (Promega #E2691), and retroviral supernatant was collected and used immediately for transfection of MC38s on days 2 and 3 following transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.4 ng plasmid encoding Renilla luciferase using FuGENE 6 (Promega). Luciferase activity was measured 48 h post-transfection using the Dual Luciferase assay kit (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: Transfections were carried out using FuGENE 6 transfection reagent (Promega #E2691) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and target (400 ng) plasmids using 6 μL FuGene HD (Promega). 72 hrs later ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2.7 μl FuGENE 6 Transfection Reagent (E2691, Promega, Madison, WI) in 1.5 ml volume ...
-
bioRxiv - Physiology 2021Quote: ... and 5 μg lentiviral construct with 30 μL Fugene 6 (Promega) the following day ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transiently transfected using Fugene 6 (Promega, Madison, WI, #E2691) as per the manufacturer’s instructions overnight in a 25-cm2 cell culture flask (Genessee Scientific Corporation ...