Labshake search
Citations for Promega :
301 - 350 of 1753 citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 ng of pRL-SV40 (Promega) Renilla luciferase construct was added to the 384-well reporter library plates and incubated for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... NanoBRET Tracer 5 (Promega, Madison, WI, USA) was used at a final concentration of 1.0 μM as previously evaluated in a titration experiment ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HaloTag TMR Ligand (5 mM) (Promega) were dissolved in DMSO (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 μM HaloTag-TMR substrate (Promega) and incubated for 15 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 µg of K562 cell lysate (Promega) or 5 µg yeast digests were injected and run on a nanoAcquity UPLC (Waters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 5 % BrightGlo (Promega, Madison, WI, USA) before reading luminescence on a Molecular Devices SpectraMax iD5 with a 1 second integration time ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg of trypsin (Promega, Sequence Grade) was added and digestion was performed overnight at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Trypsin (5 μg/ml trypsin gold (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2021Quote: ... 4.0 µL of 5× GoTaq Buffer (Promega), 2.0 µL of MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μl of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL GoTaq polymerase buffer 5x (Promega), 0.5 μL of each primer ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated 5 minutes with AttoPhos (Promega). Images were acquired with a FLA-5000 fluorescent image analyzer (Fujifilm ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5% pRL-TK Luc (Promega E2241) plasmid and 100 µL of the transfected cell suspension were seeded into a white PDL-coated 96-well flat bottom plate (Nunc) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... before cells were permeabilized using 0.2% Triton X-100 PBS for 10 min at room temperature, then blocked for 30 min (2% BSA / 0.5% fish skin gelatine / PBST.5, 2U/µL RNAsin Plus (Promega) at room temperature) ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were brought to room temperature for 5-10 minutes while 2 mL of 30 mM coelenterazine (Promega), or 15 mL of 1-to-50 diluted NanoLuc substrate (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were trypsinised on the beads in 60 μl of Buffer I (2 M urea, 50 mM Tris-HCl pH 7.5, 5 μg/ml Trypsin [modified sequencing-grade trypsin; Promega]) for 30 min at 37°C in a thermomixer ...
-
bioRxiv - Biochemistry 2019Quote: ... All samples were further diluted with 20 mM HEPES pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 μg trypsin (V5111, Promega) (1/100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were further diluted with 50 mM Tris pH 7.9 pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were diluted using one volume of dilution buffer (10 mM Tris pH 8, 0.4% NP40, 5 mM CaCl2, 2 U/mL RQ1 DNAse (Promega)) and then incubated with anti-Flag or anti-p400 antibodies coupled to agarose beads (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...