Labshake search
Citations for Promega :
301 - 350 of 4472 citations for 6H Pyrrolo 1 2 1 2 imidazo 4 5 f 2 1 3 benzoxadiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... comprised of 2% (v/v) of GloSensor reagent (Promega, #E1290 ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of Wizard DNA Clean-Up resin (Promega) was added to the solution and mixed by inversion for two minutes ...
-
bioRxiv - Biophysics 2020Quote: ... 2 x GoTaq®qPCR Master Mix (Promega, Switzerland) and 1 μl cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... the sample was digested with trypsin (2 μg, Promega) in 50 mM ammonium bicarbonate (100 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... (2) DNA template degradation by the DNaseI free (Promega), and (3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 2 µl of Fugene HD transfection reagent (Promega). The control reporter plasmid was transfected in parallel in equimolar amounts with pEGFP or pPRKRA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 μL of 20-fold diluted furimazine stock (Promega) in live cell substrate (LCS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL of CellTiter-Glo reagent (Promega, cat # G9683) was dispensed to each microplate well via BioRAPTR FRD ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μL of ONE-glo luciferase detection reagent (Promega) was dispensed per well and luminance signal recorded with an Envision plate reader (Perkin Elmer).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 mM TEAB and 2 µg LysC+trypsin (Promega) were added ...
-
bioRxiv - Microbiology 2024Quote: ... (2) addition of 600μL of Nuclei Lysis Buffer (Promega), and (3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... before cells were permeabilized using 0.2% Triton X-100 PBS for 10 min at room temperature, then blocked for 30 min (2% BSA / 0.5% fish skin gelatine / PBST.5, 2U/µL RNAsin Plus (Promega) at room temperature) ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were brought to room temperature for 5-10 minutes while 2 mL of 30 mM coelenterazine (Promega), or 15 mL of 1-to-50 diluted NanoLuc substrate (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were trypsinised on the beads in 60 μl of Buffer I (2 M urea, 50 mM Tris-HCl pH 7.5, 5 μg/ml Trypsin [modified sequencing-grade trypsin; Promega]) for 30 min at 37°C in a thermomixer ...
-
bioRxiv - Biochemistry 2019Quote: ... All samples were further diluted with 20 mM HEPES pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 μg trypsin (V5111, Promega) (1/100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were further diluted with 50 mM Tris pH 7.9 pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were diluted using one volume of dilution buffer (10 mM Tris pH 8, 0.4% NP40, 5 mM CaCl2, 2 U/mL RQ1 DNAse (Promega)) and then incubated with anti-Flag or anti-p400 antibodies coupled to agarose beads (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μg of RNA was treated with DNase 1 (Promega) for 2 hours at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 175 μg/ml 5-bromo-4-chloro-3- indolyl-phosphate (BCIP) (Promega). Reactions were stopped as the signal became apparent with three PBS rinses ...
-
bioRxiv - Cell Biology 2020Quote: ... One 10-cm plate of HEK-293T cells at 90% confluency was transfected with 6.5 μg of the pBMN-ARHGAP36 (isoform 2)-mCherry mutant library and 4 μg of pCL-ECO using the FuGene HD transfection reagent (Promega). The medium was replaced after 24 hours with DMEM containing 1.8 mM L-glutamine ...
-
bioRxiv - Biophysics 2020Quote: ... Plasmids were transfected in cells (passage number < 35) seeded in 96-well plates at ~50 % confluence 2-4 days before the experiment with FuGene6 (Promega) or Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmids were transfected in cells (passage number < 35) seeded in 96-well plates at ~50 % confluence 2-4 days before the experiment with FuGene6 (Promega) or Lipofectamine 2000/3000 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was then digested with 2.5 μg Lys-C (Wako, Japan) for 4 h at 37°C and 2 μg trypsin (Promega, V5113) for an additional 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg ml-1 Sequencing Grade Modified Trypsin (Promega). Peptides were eluted with 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 T-REx SNAPf-GLP-1R-SmBiT cells were seeded in 12-well plates and co-transfected with 0.1 μg β-arrestin-2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin-2; Promega, plasmid no. CS1603B118) and either 0.1 μg mini-Gs-Venus or mVenus supplemented with 0.8 μg pcDNA 3.1.
-
bioRxiv - Molecular Biology 2023Quote: ... Figure 6 and Figure 7) to form condensates in cells was monitored by transient transfection of U-2 OS cells using FuGene (Promega; Figures 2 and 7) or electroporation (as before ...
-
bioRxiv - Microbiology 2019Quote: ... Cross-links of input and IP material were reversed by adding 10 μl 5 M NaCl and 4 μl 10 mg ml−1 Proteinase K (Promega), and incubated for 4 hours at 65°C ...
-
bioRxiv - Neuroscience 2022Quote: DNA constructs with different WT and mutated 5’UTRs of mouse Sox2 mRNA were assembled in the psiCheck-2 vector (Promega) including synthetic Renilla luciferase gene (hRluc ...
-
bioRxiv - Biochemistry 2022Quote: ... 2ml of Sf9 cells at 0.5×106 cells per ml were transfected with 2 µg of fresh bacmid DNA and FuGene HD transfection reagent (Promega) at a ratio of 3:1 transfection reagent to DNA ...
-
bioRxiv - Molecular Biology 2021Quote: A total of 10 μg of bacmid DNA was transfected into 6 wells of 2×106 adherent Sf9 cells (at 5×105 cells/ml) using the transfection reagent Fugene HD (Promega). 42–72 h post transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... following manufacturer’s instructions using 200 ng psiCHECK™ 2 (Promega) as empty vector control or psiCHECK2 containing Tnf-α 3’ UTR or Il6 3’ UTR and 30 pmol miRNA scramble negative control ...
-
bioRxiv - Molecular Biology 2019Quote: A commercial kit (HDAC-Glo™ 2 Assays, Promega, G9590) was used to measure HDAC2 activity ...
-
A general role of zinc binding domain revealed by structures of σ28-dependent transcribing complexesbioRxiv - Molecular Biology 2020Quote: ... samples were treated with 2 U/mL DNase I (Promega) for 1 min at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... After adding 2 μl of trypsin (0.5 μg/μl, Promega), peptide mixtures were incubated at 37°C for 4 hrs ...
-
bioRxiv - Biochemistry 2020Quote: ... Before adding 2 μl of trypsin (0.05 μg/μl, Promega), 500 fmol of isotope-labeled peptides 1 and 2 were added to spike the ROS preparation ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of total RNA was treated with DNAse (Promega) and utilized as a template for the cDNA synthesis reaction using MMLV reverse transcriptase (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Amplified DNAs were cloned into pSiCHECK-2 (Promega, Wuhan, China) by utilizing XhoI and NotI restriction enzyme sites to construct pSi2-hUTR and pSi2-mUTR ...
-
bioRxiv - Neuroscience 2020Quote: ... using the GoTaq® 2-step RT-qPCR kit (Promega). Quantitative PCR runs were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems Inc. ...
-
bioRxiv - Biochemistry 2020Quote: ... T7 RNA polymerase and 2 µL RNasin RNase inhibitor (Promega) and incubated overnight at 37°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Polymerase chain reactions were performed using 2 U Gotaq (Promega), 1X Gotaq buffer (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg of 0.5 μg/μl sequencing grade trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2021Quote: To clone the 3xant-miR-275 into psiCheck-2 (Promega), two complementary single-stranded oligos that encode 3xant-miR-275 and XhoI and NotI restriction endonuclease cut sites were synthesized at Yale Keck Oligo Synthesis Resource (Table 1) ...
-
bioRxiv - Cell Biology 2022Quote: ... the protein suspension was digested with 2 µg trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were transfected with psiCHECK-2 plasmids (Promega, Madison, USA) containing two luciferase genes ...