Labshake search
Citations for Promega :
301 - 350 of 3964 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Cancer Biology 2023Quote: Apoptosis was measured by luminescent caspase 3/7 assay (Promega). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl of nuclease free water (Promega, Cat No. P119E), and 5 µl of cDNA using the following program ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Caspase 3/7 activity by Caspase-Glo (#G8093, Promega). Plates were read on a SpectraMax I3 plate reader ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the Caspase-Glo® 3/7 Assay kit (Promega), following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... with the Caspase-Glo 3/7 Assay System (Promega, G8090). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the pSARP-12R4-9 input library with a 3:1 transfection reagent:DNA ratio using Fugene 6 transfection reagent (Promega #E269A). At 72 hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Biochemistry 2021Quote: ... free thiols were alkylated by iodoacetamide and proteins were sequentially digested with endoproteinase Lys-C (Wako, 1:100 enzyme-to-substrate ratio, 3 h at 37 °C) and trypsin (Promega, 1:50, overnight at 37 °C). Digested samples were desalted ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times in TBST for 15’ per wash and incubated 1 hour in HRP-conjugated anti-rabbit (Promega, W4011) or anti-mouse (Promega ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells (∼6 × 105 cells per 6-well) were transfected with 1-3 μg of the indicated constructs using FuGENE® HD Transfection Reagent (#E2311, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was concentrated using PEG precipitation with 1 volume of PEG concentrator for every 3 volumes of supernatant (PEG concentrator: 40% (w/v) PEG 8000 (Promega, V3011) in 1× PBS (Thermo ...
-
bioRxiv - Cell Biology 2022Quote: ... t-ERK1/2 (Promega V114A, 1/1000 dilution), p-AKT (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg trypsin (protein:enzyme ratio 50:1; Promega) were added and proteins were digested at 37 °C for 18 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:2 DNA:FuGENE® HD transfection reagent (Promega) ratio and 2 μg of specific plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...