Labshake search
Citations for Promega :
3351 - 3400 of 3735 citations for Rat Neuronal Acetylcholine Receptor Subunit Alpha 7 CHRNA7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of 50 µl were analyzed in triplicate for NAD+ and NADH with the NAD/NADH-Glo Kit (Promega, Mannheim, Germany) in white 96-well plates using a Synergy HTX microplate reader ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of all the pOXA-48 bearing strains was isolated using the Wizard genomic DNA purification kit (Promega, WI, USA), and quantified using the QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Cancer Biology 2020Quote: ... Plates containing the different transfected cells were incubated for 24 hours at 37°C before the luciferase activity was measured using the Dual-Glo luciferase detection kit (Promega: E2920).
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from viral transport medium or directly from tracheal aspirates by Maxwell® RSC Blood DNA Kit per manufacturer’s instructions (Promega Corporation). RNase A was added to samples to remove potential viral RNA ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified by Quantus™ Fluorometer (Promega, USA). Purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina MiSeq PE300 platform (Illumina ...
-
bioRxiv - Immunology 2022Quote: The ADCC or cell killing activity of effector cells incubated with anti-NKG2A antibodies with LALA-PG mutation were measured through release of cytosolic LDH from dead target cells using LDH-Glo cytotoxicity assay kit (Promega, J2381). The purified NK cells from normal PBMCs (Zenbio Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... probe was generated by an in vitro transcription system using primer pairs with T7 and SP6 promoter regions (T7 and SP6 Ribomax™ large scale RNA kit, Promega) (Mlig-pro46 ...
-
bioRxiv - Plant Biology 2019Quote: ... Grown cultures were used for DNA isolation using Wizard Genomic DNA Purification Kit following the manufacturer’s instructional manual (Promega, Madison, WI).
-
bioRxiv - Pathology 2019Quote: ... Lactate Dehydrogenase (LDH) release was measured regularly (twice per week) using a CytoTox 96® Non-Radioactive Cytotoxicity Assay kit (Promega).
-
bioRxiv - Physiology 2019Quote: In vitro transcription was performed using T3 RNA polymerase and other reagents supplied in the RiboProbe In Vitro Transcription System kit (Promega, Italy) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Root tissue was ground in liquid nitrogen and total RNA was extracted with the Maxwell® 16 LEV plant RNA kit (Promega) in the Maxwell 16 AS2000 instrument (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Effects of compounds on NR4A2-AB-Gal4DBD activity was determined via end-point luciferase measurement using a Luciferase Assay System kit (Promega, Inc). The response to 6-MP (3-4-fold maximal induction ...
-
bioRxiv - Cell Biology 2019Quote: ... We then assessed cell viability of treated and control cells 48 hours post-transfection using the CellTiter Glo 2.0 luciferase assay kit (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Luciferase activity was assessed using the dual-luciferase reporter kit (TransGene, China) and performed via a dual-luciferase reporter assay system (Promega, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Microbiology 2021Quote: ... cytotoxicity tests were performed in Vero E6 cells via MTS assay using the CellTiter 96® Non-Radioactive Cell Proliferation kit (Promega) as previously described (37) ...
-
bioRxiv - Cell Biology 2020Quote: ... and results were normalized to living cell numbers as evaluated with the CellTiter 96® AQueous One Solution Cell Proliferation Assay Kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: Total mRNA was isolated from tissues using a Maxwell® LEV simply RNA Cells/Tissue kit (cat# AS1280, Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using Maxwell® 16 automated system (Maxwell® 16 Cell DNA kits, Promega, Madison, WI, USA). Extracted DNA samples were quantified using NanoDropTM 2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we found we did not obtain clean results unless we first used a genomic miniprep kit to purify DNA (Promega Wizard). We inverted the colors for all agarose gels to assist visualization.
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Immunology 2021Quote: CD8+ T cell cytotoxicity was assessed using a Cyto Tox 96® Non-radioactive Cytotoxicity Assay kit (Promega, Cat no. G1780) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: RNA was isolated from single pupal terminal samples dissected at 24 hours APF or 28 hours APF using the Maxwell® 16 Tissue DNA Purification Kit (Promega). Poly-A RNA-seq libraries were generated using a Clontech library preparation kit (040215) ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The resulting PCR products were extracted from 2% agarose gel and further purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences) and were quantified by QuantiFluor™-ST (Promega).
-
bioRxiv - Plant Biology 2019Quote: ... The PCR products were purified using a HiPure Gel Pure DNA Mini Kit (Magen, D2111) and cloned into the pGEM-T Easy Vector (Promega, A1360). For each sample ...
-
bioRxiv - Synthetic Biology 2019Quote: Measurements of luminescence intensity from the amber initiator plasmid system was performed as before15 using the NanoYGlo Luciferase Assay System kit (Promega, #N1110) with the following modifications ...
-
bioRxiv - Genomics 2021Quote: ... the strain was cultivated on PD2 medium as described (Su et al., 2016) for DNA extraction using Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Yeast genomic DNA was prepared from 1 ml cultures grown in rich media from single colonies or Ade− half-sectors using the Wizard® Genomic DNA Purification Kit (Promega). Genomic DNA (150 ng ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Cell Biology 2020Quote: ... The resulting lysates were used to measure the humanized renilla (hRluc) and firefly (hluc) luciferase activities with the Dual-Luciferase Reporter Assay kit (Promega, E1960) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The NAD+/NADH ratio was measured using a protocol adapted from the manual of the NAD/NADH-Glo Assay kit (Promega G9072)2 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, USA). The qualified PCR products were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... then left for 48 hrs before measuring the ATP content using CellTiter-Glo® assay kit (Promega, Madison, WI, USA, G7570) [47] ...
-
bioRxiv - Physiology 2021Quote: ... Extracts were used for quantification of luciferase as proxy for ATP content using the ENLITEN® ATP Assay System Bioluminescence Detection Kit (Promega) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: To isolate RNA from cell lines we followed the manufacturer's instructions of the Maxwell 16 LEV simply RNA Kit (# AS1280) (Promega, Walldorf, Germany). Quantification of mRNA was performed using the BRYT Green® Dye (GoTaq® qPCR ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The viability of the cultures was determined 24 h and 48 h after EV treatments by using the CellTiter-Fluor cell viability assay kit from Promega (G6080) following manufacturers instructions ...
-
bioRxiv - Microbiology 2021Quote: ... supernatant was harvested from Calu-3 cells and inactivated by addition of lysis buffer (Maxwell 16 viral total nucleic acid purification kit, Promega #AS1150) complemented with proteinase K ...
-
bioRxiv - Microbiology 2021Quote: RNA from lysed and heat-inactivated samples was purified according to the instructions of the manufacturer using Maxwell 16 viral total nucleic acid purification kit (Promega, #AS1150) or Maxwell 16 LEV simplyRNA cell kit (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was assessed three days post-infection by MTS assay using the CellTiter 96® Aqueous Non-Radioactive Cell Proliferation kit (Promega) and absorption was measured at 495 nm with an EnVision Multilabel Plate Reader (PerkinElmer) ...
-
bioRxiv - Immunology 2021Quote: MSCs and B cells proliferation were measured using the CellTiter 96® AQueous cell proliferation assay kit from Promega (Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... small leaves and witches’ broom) (Figure 1B) were collected for total genomic DNA extraction using the Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2019Quote: ... with a Maxwell 16 instrument using Maxwell 16 LEV SimplyRNA Blood kits according to the manufacturer’s protocol (Promega, Madison, WI, USA). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the aerial portions of 10-day old seedlings using the Wizard® Genomic DNA Purification Kit (Promega) following manufacturer’s instructions ...