Labshake search
Citations for Promega :
3251 - 3300 of 3657 citations for Borrelia burgdorferi sensu stricto B31 CRASP 1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Samples were diluted to a concentration of urea of 2 mol L-1 and digested overnight with the addition of 2 µl sequencing-grade trypsin (Promega). After digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... The reduced and alkylated protein lysates were diluted using 50 mM Tris-Cl to obtain a final concentration of 2 M urea in solution followed by overnight digestion with trypsin (1:1000)(Promega). Peptides were then desalted using c-18 Sep-Pack columns (Waters) ...
-
bioRxiv - Immunology 2020Quote: ... anti-m6 A conjugated beads were incubated with purified mRNA with rotation at 4C overnight in 300 mL MeRIP buffer with 1 mL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...
-
bioRxiv - Immunology 2020Quote: ... the cells were washed with PBS and then lysates were prepared by scraping the cells from plates in the presence of 1× Passive lysis buffer (Promega). Luciferase assays were performed according to Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... cells were washed in 1 x PBS and cell viability was assessed using CellTiter-Glo Luminescent Cell Viability Assay (Promega). Luminescence read-out was normalized to signal from vehicle treated cells and represented as percentage of viable cells compared to vehicle ...
-
bioRxiv - Bioengineering 2021Quote: ... knees were injected with 50 μL furimazine (1:50 dilution in PBS, Nano-Glo™, PRN1120, Promega, Madison, WI, USA), then assessed with the above IVIS settings ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Plates were incubated at 25 °C for 1 hr and fluorescence was measured using a BioTek Synergy Neo plate reader (Promega). The terbium (Tb ...
-
bioRxiv - Immunology 2020Quote: ... 293T cells were co-transfected with envelope-expressing plasmid and an env-deleted HIV-1 backbone plasmid (pSG3ΔEnv) using a FuGENE6 transfection kit (Promega Inc.). Cell supernatants containing pseudotyped viruses were harvested 48 h post transfection and used for infection in TZM-bl cells using DEAE-dextran (25 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... the plates were washed with PBS and the cells were lysed with 1× reporter lysis buffer (100 µl per well; Promega). Following a freeze-thaw cycle ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4·3Δenv-Luc and Spike-Δ19-D614G by using Profection mammalian transfection kit (Promega Inc) following the instructions in the kit manual ...
-
bioRxiv - Immunology 2020Quote: Replication-competent NL4-3YU219 HIV-1 molecular clone was used to transfect HEK 293T cells using the FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48 hours post transfection and stored at −80°C or −150°C.
-
bioRxiv - Cell Biology 2021Quote: ... were grown in complete medium supplemented with 1 mM sodium pyruvate and transfected with pQCXIP-GalT-EGFP using FuGENE HD (Promega) to produce viral particles ...
-
bioRxiv - Immunology 2021Quote: ... Fluorescence of FITC-dextran in serum was diluted to 1:10 with PBS and measured on a Promega GloMax Multi Detection System (Promega) at 490 nm excitation and 520 nm emission wavelengths ...
-
bioRxiv - Cell Biology 2021Quote: ... Beyotime) for 10 min at 37°C and the other was treated with 1 U/ul RNase inhibitor (N2518, Promega). For chromatin extraction ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 μL of cDNA was used for 25 μL PCR reactions using the GoTaq Hot Start Master Mix (Promega). Cycling parameters consisted of an initial denaturation of 95°C for 2 min. ...
-
bioRxiv - Genomics 2021Quote: ... 8 μg of RNA were treated for 1 h at 37°C with 12 units of RQ1 DNase (Promega®) followed by phenol-chloroform extraction and ethanol precipitation of RNA which was subsequently dissolved in water ...
-
bioRxiv - Immunology 2021Quote: ... caspase-1 activity in the cell culture supernatants was measured using Caspase-Glo® 1 inflammasome assay according to the manufacturer’s instructions (Promega). Luminescence was measured using an Omega plate reader.
-
bioRxiv - Neuroscience 2021Quote: ... The transfected cells were then treated with Aβ42 (1-4 μM) or calcitriol (100 nM) for 6 h before luciferase activity assay (Dual-Luciferase Reporter Assay, Promega). A 587-bp region of the human Cyp24a1 gene promoter that contains two VDRE motifs was cloned into the promoter-less luciferase expression vector pGL3-basic (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... of 50mM Tris-HCl pH 8.5 containing LysC (Wako Chemicals) at 1:100 (w/w) ratio and trypsin (Promega V5113) at 1:100 (w/w ...
-
bioRxiv - Immunology 2022Quote: ... and a non-target control (NT-Ctrl) along with the packaging plasmids (pHCMV-G, and pHCMV-HIV-1) (44) using FUGENE-HD transfection reagent (Promega). The mouse Drp1-targeted shRNA plasmid with the sense sequence of GGCAATTGAGCTAGCTATA ...
-
bioRxiv - Genetics 2022Quote: ... we added 25 uL Dulbecco’s PBS and 25 uL of reagent 1 from the Dual-Glo luciferase kit (Promega Inc.) and mixed well to lyse the cells ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293 cells were cultured as described (Poliakov et al., 2008) and transfected with 1 µg of the appropriate plasmid using FuGENE HD transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... S2-VP10 cells were co-transfected with 0.5 μg of each luciferase reporter plasmid and 1 ng of pRL-SV40 (Promega, E2231) the day after plating (3.45 × 104 cells/well in a 24-well plate ...
-
bioRxiv - Genomics 2022Quote: ... A single colony was used to inoculate LB Broth and genomic DNA extracted from 1 mL using a Promega Wizard kit according to the manufacturer’s instructions (Promega, USA). DNA was quantified using the Qubit 3 and Nanodrop (Thermofisher ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega).
-
bioRxiv - Microbiology 2022Quote: ... The cells were incubated for 24 hrs at 37 °C (for HEK-293T) or 39 °C (DF-1) and luciferase activity was measured by using the Dual-Glo luciferase assay system (Promega). The polymerase activity was calculated by normalising firefly luciferase activity relative to the Renilla luciferase activity.
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was transcribed from 1 ug of MIuI-linearized DNA using T7 RiboMAX Express Large Scale RNA Production System (Promega). Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4·3Δenv-Luc and Spike-Δ19-D614G by using profection mammalian transfection kit (Promega Inc.). After 48 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then diluted with 50 mM NH4HCO3 to a final concentration of less than 2M urea and then and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then diluted with 50 mM NH4HCO3 to a final concentration of less than 2M urea and then and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were purified on a 1% agarose gel and ligated into a pGEM-T Easy Vector Systems (Promega) plasmid followed by transformation in E ...
-
bioRxiv - Plant Biology 2022Quote: ... The coding sequence of nLUC (aa 1-416) and cLUC (aa 398-550) were amplified from pSP-LUC+NF (Promega) and inserted between ApaI and XbaI in pSAT1A-cYFP-N1 (ABRC ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... and the resulting products were checked on agarose gel (1%) and purified using the Wizard SV Gel and PCR Clean-Up System (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cells were infected with HIV-1 for 48 hours before luminometric quantification of luciferase activity using the Luciferase Assay System (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of extracted DNA was added to an amplification mixture containing 1 µl (10 µM) of primers and 12.5 μl of PCR Master Mix Plus (Promega, USA). To each mixture ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... QRT-PCR reactions were performed by using the GoTaq®1-Step RT-qPCR System (Promega Scientific, Madison, WI, USA) with Bio-Rad CFX Connect (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was removed and pellet was resuspended in 400 µL of sort buffer (1 mM EDTA 0.2 U/µL RNase inhibitor (Promega, N211B), 2% BSA (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21ºC overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Afterwards the samples were diluted to decrease the concentration of urea up to 1 M and supplemented with additional amounts of sequencing-grade trypsin (Promega) (200 ng for pull-down samples and 1 ug for total lysate samples) ...
-
bioRxiv - Microbiology 2024Quote: ... SL100688) with the exception of BCBL-1 cells that were transfected with FuGENE HD transfection reagent (Promega, Cat. No. E2311,). Competition reporter assays were performed with co- transfection of the TR7 reporter plasmid with or without LANA expression plasmid (DY52) ...