Labshake search
Citations for Promega :
3151 - 3200 of 3826 citations for Mouse IL 13 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Using the primers provided in Supplementary Table 3 we performed PCRs on 40 ng of genomic material extracted from wild type mosquitoes of the G3 strain using the Wizard Genomic DNA purification kit (Promega). The primers were modified to contain suitable Gibson assembly overhangs (underlined ...
-
bioRxiv - Genetics 2020Quote: ... They were grown to adulthood and their gDNA was individually extracted using either the Wizard Genomic DNA purification kit (Promega) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were harvested by trypsinization and RNA was isolated using Maxwell LEV simply RNA Cells/Tissue Kit (Promega, Madison, USA), according to the company’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Both human cell lines were validated using the cell line authentication service at Duke University and confirmed using the GenePrint 10 kit from Promega and tested to be mycoplasma-free ...
-
bioRxiv - Plant Biology 2019Quote: ... Ten µl of each cell lysate were used for dual luciferase assay by applying 50 µL of freshly prepared LARII and Stop&Glo reagents of the Dual Luciferase Assay kit (E1910, Promega). The luciferase intensity values of firefly and Renilla luciferases were measured sequentially by collecting one second of integrated chemiluminescence intensity (using gain 240 ...
-
bioRxiv - Plant Biology 2019Quote: ... Ten µl of each cell lysate was then transferred into another plate and used for dual Luciferase assay applying a quarter of the recommended volume of each reagent of the Dual Luciferase Assay kit (E1910, Promega). The substrates were added by an automated pump of the FLUOstar Omega Microplate Reader (BMG LABTECH ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were validated by DNA fingerprinting through the University of Colorado Molecular Biology Service Center utilizing the STR DNA Profiling PowerPlex-16 HS Kit (DC2101, Promega)(Table S4).
-
bioRxiv - Microbiology 2019Quote: ... synthesized by in vitro transcription of a NdeI-linearized pGEM-T plasmid containing the 135bp cDNA target fragment using the T7 RiboMAX in vitro transcription kit (Promega). Negative controls (without template RNA and RNA from mock-infected cells ...
-
bioRxiv - Immunology 2019Quote: ... Viral RNA was extracted from 300μL of plasma using the Viral Total Nucleic Acid Purification kit (Promega, Madison, WI, USA) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Pathology 2020Quote: The cellular ATP levels were quantified in 100 μL ATP assay buffer or from 20-30 mg wound skin harvested in 200 μL assay buffer and lysed with the bead shocker following the manufacturer’s instructions (CellTiter-Glo luminescent ATP assay kit, Promega, Madison). The protein content from identical treated cells or tissues were determined by BCA Protein Assay kit for normalization (Young ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Genomics 2019Quote: ... The reporter plasmids and β-gal expression plasmids were cotransfected in K562 cells and luciferase assay was carried out after 48 hours using Nanoglo luciferase kit (Promega) and normalized to ß-gal expression measured using assay reagent (ThermoFisher).
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The overlapping PCR products were separated and purified by the Spin Column PCR Product Purification Kit (Wizard SV Gel and PCR Clean-Up System) following manufacturer’s instruction (Promega, WI). Then ...
-
bioRxiv - Bioengineering 2020Quote: We used the method of ATP-based luminescent cell viability assay with the Kit named CellTiter-Glo Luminescent Cell Viability Assays (Promega). 5×104 cells in 100 μL of DMEM medium per well were seeded in a 96-well opaque white polystyrene microplate (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase digestion of cellular RNA was verified by purifying RNA from supernatant after immunoprecipitation using Reliaprep RNA purification kit (Promega) and then analyzing it by denaturing formaldehyde-agarose gel electrophoresis followed by imaging of the ethidium bromide stained gel.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: The AP-1 luciferase reporter was expressed using an adenoviral vector and luciferase activity determined using a luciferase assay kit from Promega as previously described (Higazi et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... were detected by the alteration of the dose-response curve measured using CellTiterGlo Chemoluminescent Kit (Promega Corporation, Cat. No.: G7573). Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... coli was grown in NB liquid medium (180 rpm, at 30 ° C) and had its DNA extracted with Wizard Genomic DNA Purification Kit (Promega). The number of bacteria in the seed and root was calculated based on the values of Ct (cycle threshold ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were harvested at various time points of differentiation over a period of 11 days and then analyzed using a Dual-Glo luciferase assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then excised and purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega, Madison, WI) according to manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Amplification products were checked on a 1% agarose gel and were purified using the Wizard PCR clean-up kit (Promega). DNA concentration and purity were measured using a ND-1000 UV-Vis Spectrophotometer (Nanodrop Technologies).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were washed once with PBS and their viability was measured with a kit designed to quantify ATP level according to instructions of the manufacturer (CellTiterGlo Luminescent Cell Viability Assay, Promega).
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from 300□μl of plasma using the Viral Total Nucleic Acid Purification kit (Promega, Madison, WI, USA) on a Maxwell 16 MDx instrument ...
-
bioRxiv - Microbiology 2020Quote: ... coli was grown in NB liquid medium (180 rpm, at 30 °C) and had its DNA extracted with Wizard Genomic DNA Purification Kit (Promega). The reference DNA was diluted in series of 10−2 to 10−8 (20 – 2 × 109 ng of DNA) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was evaluated using the MTS-based CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega, G3582), which determines viable cell number measuring the conversion at 490 nm of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS ...
-
bioRxiv - Microbiology 2020Quote: ... The amounts of LDH were measured spectrophotometrically using a Cyto-Tox 96 Non-radioactive Cytotoxicity Assay Kit (Promega, Madison, WI). We added 50 μL of 10 %Triton X-100 to the 950 μL of extracellular medium of L2 cells in 24-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... The full-length cDNA and EcoRI digested pKTO-IBV-N were subjected to in vitro transcription using T7 transcription kit (Promega), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... from 12-72 hpt and luciferase activity was measured using the Dual Luciferase reagent kit and GloMax multi detection system (Promega). Firefly luciferase readings from the TBEV replicons were normalized to the Renilla values (pTK-Ren ...
-
bioRxiv - Microbiology 2021Quote: Extraction of cellular DNA and viral DNA was conducted using Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin, USA) and QIAamp MinElute viral DNA extraction kit (QIAGEN ...
-
bioRxiv - Plant Biology 2020Quote: ... Gene PCR products of 200-300 bp were labelled with 32P-dCTP following the prime-a-gene labelling kit instructions (Promega) and used as probes (Supplementary Table 1) ...
-
bioRxiv - Genetics 2021Quote: ... Cell death was analyzed similarly using a commercially available kit that labels fragmented DNA from apoptotic cells (DeadEnd Fluorometric TUNEL System, Promega).
-
bioRxiv - Pathology 2021Quote: ... Cell viability was monitored by measuring lactate dehydrogenase (LDH) leakage into the culture medium by using the CytoTox96 Non-Radio Cytotoxicity Assay kit (Promega). For adherent cells (HFFs ...
-
bioRxiv - Synthetic Biology 2020Quote: Cells from HAC-containing clones have been harvested and genomic DNA has been collected using Maxwell DNA purification kit (Promega). qPCR analysis have been performed using SYBR Green Master Mix (Roche ...
-
bioRxiv - Zoology 2020Quote: ... Genomic DNA was extracted from the selected body part using Promega Wizard® Genomic DNA Purification kit (A1120, Promega, UK) and DNA dissolved with 100 ul of molecular water and stored in −20°C for the future use.
-
bioRxiv - Microbiology 2020Quote: ... PCR reaction mixtures were solved in 1% (w/v) agarose gel and purified by means of Wizard SV gel and PCR Clean Up kits (Promega). The amplified gene was treated with Taq polymerase (Fermentas ...
-
bioRxiv - Cancer Biology 2021Quote: Proliferation was measured by a MTS conversion assay using the CellTiter 96 Aqueous Non-Radioactive Cell Proliferation kit (#G5421, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was purified using the Direct-Zol RNA Microprep Kit (Ozyme) according to the recommendations provided and was quantified using the QuantiFluor RNA system (Promega). One μl of 10 μM of oligo-dT primer and 1 μl of 10 μM of dNTPs were added to 0.3 ng of total RNA in a final volume of 2.3 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were cultured in the presence of signaling proteins for another 24 hours before being washed and lysed as suggested by the instructions in the Dual Luciferase Assay Kit (Promega) manual ...
-
bioRxiv - Biophysics 2019Quote: ... coli HB101 cells and isolated in quantity by using a Promega Wizard Plus Megaprep purification kit (Promega Corp., Madison, WI).
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: Southern blotting was performed in accordance Koch et al.19 Genomic DNA was prepared using the Wizard Genomic DNA Purification kit (Promega) and digested with SspI-HF and MfeI-HF (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... we extracted the genomic DNA from two samples of each group using the Wizard Genomic DNA purification kit (Promega, A1120). The DNA concentration was measured by the Qubit dsDNA Broad-Range Assay (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit, Promega).
-
bioRxiv - Genetics 2020Quote: The frameshifting efficiency of the reporter plasmids in cultured cells were assayed as described previously (15, 16) using a dual luciferase reporter assay system kit (Promega). 24 hours post transfection ...
-
bioRxiv - Immunology 2021Quote: Toxicity was measured by quantifying the cell viability using the CytoTox-ONE™ Homogeneous Membrane Integrity Assay kit (Promega, G7891) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... An overhang was added to purified Or67b amplicons with Taq polymerase (Fermentas) and cloned using the pGEM-T Easy cloning kit protocol (Promega). Plasmids were extracted and purified using the GenElute plasmid miniprep kit (Sigma-Aldrich ...