Labshake search
Citations for Promega :
3101 - 3150 of 3351 citations for 7H Pyrrolo 2 3 d pyrimidine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5 μL culture were added to 45 μL NanoGlo reagent (1x Promega lysis buffer and NanoGlo reagent; Promega). The average luminescence of the background cultures was subtracted to the average luminescence of each sample.
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription reactions were performed by adding 0.5 µl (corresponding to 5 U) of AMV Reverse Transcriptase (Promega), 0.1 µl dNTP mix (10 mM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... lactate assay was performed using 5 µl of media and the luminometric Lactate-Glo assay kit (Promega, #J5021) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... plates were incubated at 37°C for 72 hours prior to assessing luciferase activity using the Renilla-Glo Luciferase Assay System (Promega, Madison, WI, USA). Readout of eGFP was done by incubating and monitoring plates at 37°C for 72h in an IncuCyte® (Essen BioScience Inc. ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was prepared from a single colony cultured overnight at 37°C in LB using the Maxwell 16 system (Promega Corp., Madison, WI). Libraries for Illumina sequencing were prepared using either Nextera XT (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were then diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration of 2M urea and then re-incubated overnight at 37°C with 1 µg Sequencing Grade Modified Trypsin (Promega, Madison, WI, USA). A second incubation with the same amount of trypsin (5 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... for 20 min at 56°C before DNA was purified with Maxwell® RSC Blood DNA Kit (Promega Pte. Ltd., Cat. No. AS1400). DNA concentration was quantified using Qubit® 2.0 fluorometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... and the RNA was precipitated with an equivalent volume of isopropanol and incubated at 55°C for 10 minutes before being resuspended in 50 μL of RNase-free water (Promega, Madison, WI, USA). We determined the concentrations of RNA using a Smart-Spec plus spectrophotometer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transfected cells were cultured at 37°C for 36 h and subjected to luciferase activity analysis using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Plant Biology 2022Quote: ... They were later subjected to reverse transcription for 45 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madison, WI, USA) in the appropriate buffer.
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcribed and translated FLAG-tagged ERRα protein was made using the TnT reticulocyte reaction (Promega cat #L1170, 2h on 37°C) or the TnT wheat germ extract (cat #L5030 ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Cell Biology 2024Quote: ... BP1425-500) at 37 °C and the plasmid was isolated from single colonies using the PureYield Plasmid Midiprep kit (Promega, Cat no. A2495), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 25 µg of phloem sap and 50 µg of leaf tissue protein extract were then digested in solution using a Trypsin/Lys-C mixture (Mass Spec Grade, Promega, Madison, WI, USA) according to the instruction manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... Seventy micrograms of protein were digested overnight using the filter-aided sample preparation (FASP) method 23 with Trypsin/Lys-C mix (Promega, Madison, WI, USA) (enzyme-to-protein ratio 1:35 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was diluted either 1:5 or 1:10 for all qPCR experiments and GoTaq qPCR Master Mix (Promega) was used to amplify cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were then diluted to 2 M urea final concentration via the addition of 20 mM HEPES pH 8.0 and digested overnight with 5 µg/ml sequence-modified trypsin (Promega) at room temperature.
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Immunology 2019Quote: ... and the pellet was resuspended in 20 mL buffer A (NaPO4 20 mM, NaCl 500 mM and imidazole 20 mM, pH 7,4) containing 5 U of DNAse (Promega) and 30 ug/mL lysozyme (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of forward and reverse primer (5 μM, see Supplementary Table 1) and 5.5 μL of Nuclease-free Water (Promega). The PCR I was performed as follows ...
-
bioRxiv - Immunology 2021Quote: ... for 48h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μL of DNA or 5 μL of cell lysate were mixed with 12.5 μL of GoTaq Colorless Master Mix (Promega), 1 μL of forward and reverse primer (5 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 5 min quenching with 100 mM glycine and permeabilization with 0.5% Triton X-100 (Promega, Madison, WI) in 1 × PBS for 15 min ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... These cells were transfected 24 h later with 2.5 µg of pcDNA3-PPARγ2 (wild-type or mutated) in the presence of the Fugene HD transfection reagent (Promega). PPARγ2 transient overexpression in the UMUC3 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was reduced with 5 mM DTT and alkylated with 14 mM iodoacetamide followed by digestion with trypsin (1:100, w:w) (Promega) as described in [80] ...
-
bioRxiv - Biophysics 2021Quote: ... The reaction was incubated at 30 °C for 5 hours and 2.5 µL of the reaction mix was added to 50 µL of luciferase assay reagent (Promega) pre-equilibrated in room temperature ...
-
bioRxiv - Cell Biology 2021Quote: cDNA synthesis was performed using 1-5 μg of total RNA with random hexamers and reverse transcriptase (Promega, GoScript). Quantitative RT-QPCR was performed in triplicate for each samples using the KAPA SYBR PCR kit (Sigma Aldrich KK4600 ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... a second jar of xylene for 5 min then incubated in a series of ice-cold solutions with 0.0025% RNasin Plus (Promega): 100% ethanol for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Liquid was removed and gel pieces were dehydrated in 100% ACN at RT for 5 min at 2,000 rpm followed by rehydration in 100 mM NH4HCO3 containing 14 ng/μL trypsin (Promega) on ice for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega, WI, USA). Purified PCR fragments and pGEM cloning 5’-terminal sequence of BToV were sequenced using primers designed for every ∼300 bp of the BToV genome ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of template DNA was added to 5 μl Green GoTaq Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 1.25 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Pathology 2022Quote: ... G490 5 × All-In-One RT MasterMix (abm) was used for reverse transcription according to the manufacturer’s protocol (Promega). The qRT-PCR analysis was performed in 96-well plates using the BIO-RAD CFX96 detection system ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplifications were carried out in a total reaction volume of 10μL containing 5 μL of 2xGoTaq master mix (Promega) and 2.5 μL of 4M betaine ...
-
bioRxiv - Plant Biology 2020Quote: ... proteins were precipitated overnight with 5 volumes of cold 0.1 M ammonium acetate in 100% methanol and digested with sequencing-grade trypsin (Promega) and each sample was analyzed by nanoLC-MS/MS on a QExactive+ mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (40Ul/µl stock, 5 ml/ml of buffer, Promega). We rinsed sections ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs], 0.5 µl RNasin [N2615, Promega GmbH] ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK cells were transfected with 5’UTR-reporters for 24h using ViaFect reagent according to the manufacturer’s protocol (Promega). Next ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...