Labshake search
Citations for Promega :
3001 - 3050 of 3876 citations for Urea Nitrogen Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were harvested 48 hours post-transfection and genomic DNA was extracted using the Wizard® SV Kit (Promega). Genomic targeting efficiency for each gRNA was determined through annealing and digestion with T7 Endonuclease I (NEB ...
-
bioRxiv - Biochemistry 2021Quote: Caspase-3/7 activity was quantified by fluorometric assay using ApoONE Homogeneous Caspase-3/7 Assay Kit (Promega, US). AU565 cells ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Relative cell viability was determined using a Cell counting kit-8 (Dojindo) and read on a microplate reader (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... 3βHSD and FSHR in the supernatant of cultured GCs were quantified using GoTaq® qPCR Master Mix Kit (Promega) as previously described [29] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA was extracted from clinical samples (300μl) via a Maxwell 48 device using the Maxwell RSC Viral TNA kit (Promega) with a viral inactivation step using Proteinase K ...
-
bioRxiv - Immunology 2020Quote: ... The identity of the Huh7 cells used in this study was verified by using the GenePrint STR kit (Promega) (DNA Analysis Facility ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was isolated from whole mount larvae or dissected tissue using the Maxwell RSC simplyRNA Tissue kit (Promega Corp. ...
-
bioRxiv - Genomics 2021Quote: ... We extracted the total RNA of the larval stage using ReliaPrep RNA Tissue Miniprep kit (Promega, Madison, WI/USA) according to the supplier’s recommended protocol ...
-
bioRxiv - Biochemistry 2020Quote: The microbial viability was assessed in equalized bacterial cultures using the BacTiter-GloTM Microbial Cell Viability Assay kit (Promega) according to the manufacturer’s recommendations and luminescence was measured using a VarioSkan plate reader (Thermo Scientific).
-
bioRxiv - Immunology 2020Quote: ... The culture supernatants were collected and analysed for lactate dehydrogenase (LDH) by a commercially available CytoTox 96 Non-radioactive Cytotoxicity Assay kit according to the manufacturer’s (Promega) instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The identity of the Huh7 cells used in this study was verified by using the GenePrint STR kit (Promega) (DNA Analysis Facility ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from filter paper punches using the manufacturer’s protocol for Promega Maxwell DNA IQ Casework Sample kit (Promega) or Qiagen DNA Blood kit (Qiagen) ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... cDNA was generated from 1 μg total RNA per sample using the M-MLV Reverse Transcriptase kit (M1705, Promega). To detect RNA transcript of targeted genes ...
-
bioRxiv - Cancer Biology 2022Quote: ... The anti-proliferative effects of these compounds were assessed using the Cell Titer Glo assay kit (Promega Cat. # G7570) following manufacturer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were stimulated on the next day and lysed after 24 hrs following manufacturer’s protocol in Dual Luciferase Assay kit (Promega). Luminance signal readings were performed using or SpectraMax i3x (Molecular Devices) ...
-
bioRxiv - Microbiology 2022Quote: ... [32P]-dCTP labelled hmbA and 18S rRNA gene-specific DNA molecules were used as gene probes using the random hexanucleotide-primer kit following the supplier’s instructions (Promega). As a loading control ...
-
bioRxiv - Microbiology 2022Quote: ... PPMP was assessed for cytotoxicity at the indicated concentrations with a CytoTox96 non-radioactive cytotoxicity colorimetric assay kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA was extracted from 293T cells using an Eastep Super Total RNA Extraction Kit (LS1040, Promega, WI, USA). Reverse transcription was conducted using GoScriptTM Reverse Transcription Mix and Random Primers (A2800 ...
-
bioRxiv - Immunology 2022Quote: ... the samples were thawed and aliquoted in technical duplicates for detection of firefly and renilla luciferase activity using the Dual-Luciferase Reporter Assay kit using the GloMax luminometer to the manufacturer’s specifications (Promega). Promoter activity was determined by normalising firefly luciferase values to renilla luciferase values and expressed as relative light units (RLU).
-
bioRxiv - Microbiology 2022Quote: PCR amplicons were gel extracted using the QIAquick gel extraction kit and ligated into pGEM-T Easy plasmid (Promega). Vectors containing the PCR products were then cloned into chemically competent E ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of cells was then processed using the Promega Wizard® genomic DNA preparation kit (Promega, WI, USA) to obtain genomic DNA ...
-
Throat colour polymorphism in relation to sex and body size of the Litter skink, Lankascincus fallaxbioRxiv - Zoology 2022Quote: ... black and white throat colored individuals using Promega Wizard® genomic DNA purification kit (Promega Corporation, Madison, Wisconsin, USA) following manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... Viability of MV-4-11 cells was assessed using the CellTiterGlo 2.0 kit from Promega (as per manufacturer instructions); viability of HPAFII cells was assessed using PrestoBlue reagent from Thermo Fisher (as per manufacturer instructions) ...
-
bioRxiv - Bioengineering 2024Quote: ... organoid viability was measured by using a luminescence-based CellTiter-Glo 3D® cell viability assay kit (G9681, Promega) and recording luminescence intensity with a microtiter well plate reader (BioTek® Cytation 5).
-
bioRxiv - Bioengineering 2024Quote: The viability of cells was analyzed by using the CellTiter-Glo® 3D cell viability assay kit (Promega; G9681) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2023Quote: ... Renilla luciferase internal control vector pRL-TK and the dual luciferase reporter assay kit were from Promega (Madison, WI). Phusion PCR enzyme ...
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Neuroscience 2024Quote: ... RNA (1000ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript reverse transcriptase kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Neuroscience 2024Quote: ... Blood and iPSC genomic DNA were extracted through Promega Wizard™ Genomic DNA Purification Kits (Promega, Madison, WI, USA). Array comparative genome hybridisation (array-CGH ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: Genomic DNA from different isolates was obtained from pelleted overnight cultures using the Wizard Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: DNA purification from agarose gel was done using Wizard SV Gel and PCR Clean-Up System Kit from Promega as per manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: DNA purification from PCR mixture was done using Wizard SV Gel and PCR Clean-Up System Kit from Promega as per manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... 293T cells were harvested and luciferase and renilla activities were detected using the Dual-luciferase reporter assay kit (Promega) in a Glowmax 20/20 luminometer (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... lactate dehydrogenase (LDH) was measured from leukocyte supernatants using CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega; Cat. No. g1780) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... lactis CICC 6242 strain producing nisin A was extracted using a “Wizard Genomic DNA Purification” kit (Promega, Madison, USA). The nisA and nisRK genes were amplified through a polymerase chain reaction using the primers listed in Table 1 [29] ...
-
bioRxiv - Microbiology 2022Quote: The HEV replicon plasmids were linearised with BglII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... Sequences of all plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Cat# 063001) with a Spectrum Compact CE System (Promega). The psPAX2-IN/HiBiT plasmid was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2022Quote: pSK-E2-nLuc replicon plasmid was linearised with BglII and pUC-HEV83-2 replicon plasmid was linearised with HindIII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2023Quote: Monitoring cell viability in real time was performed by the RealTime-Glo MT Cell viability assay kit (Promega, G9713) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Amount of ATP release in response to compound were measured by Celltiter-Glo 2.0 cell viability assay kit (Promega) as per the manufactures’ protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega). All experiments were performed in biological triplicates.
-
bioRxiv - Biochemistry 2023Quote: ... Luminescence values were normalized by amount of live cells in vehicle control-treated wells (CellTiter-Glo 2.0 Assay Kit, Promega). CTG reagent was added to vehicle control-treated wells in triplicate 15 min after addition of the cAMP-glo Max Assay kit ONE buffer.
-
bioRxiv - Microbiology 2023Quote: The potential for M2e-specific antibodies to induce ADCC was evaluated using a mouse FcγRIV ADCC Reporter kit (Promega). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... The number of viable cells was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega G3580) and absorbance at 490 nm was measured by a plate reader (CLARIOstar ...
-
bioRxiv - Genomics 2023Quote: ... Protocol for cell lysis and measurement of the activities of the firefly luciferase (Dual-Luciferase Reporter Assay kit, Promega), with normalisation using the Renilla luciferase activity ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were collected for a luciferase activity assay using a dual-luciferase assay kit (Promega, Madison, WI, USA). The normalized luciferase activity was obtained by using the formula ...