Labshake search
Citations for Promega :
2951 - 3000 of 8253 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from organoids using the Simply RNA Tissue kit (Promega, AS1340) on the Maxwell RSC 48 instrument (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... 35 and 42 were extracted with Wizard® Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fragments excised from the gel purified by the DNA Purification kit (Promega) according to the maker instructions.
-
bioRxiv - Biochemistry 2020Quote: ... Luciferase activity was then measured using a commercial dual luciferase assay kit (Promega), after which firefly luciferase activity was normalized to Renilla activity and the values for the control groups were set to one.
-
bioRxiv - Plant Biology 2021Quote: ... APOLO was transcribed using the T7 transcription kit (Promega; (Ariel et al., 2020)) ...
-
bioRxiv - Neuroscience 2020Quote: ... and luciferase signals were measured with Dual-Glo® Luciferase assay kit (Promega) using GENios pro plate reader (Tecan) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the luciferase assay was performed using Dual-Luciferase Reporter Assay System kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... TUNEL staining on tissue sections was performed using the DeadEnd™ kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... luciferase activity was measured with a Dual-luciferase reporter assay kit (Promega, USA).
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Wizard DNA Purification kit (Promega, Madison, Wisconsin) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted using the SV Total RNA Isolation kit (Promega, Wisconsin, USA). RNA was DNase treated using the Turbo DNase kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Bioluminescence generated by Gaussia luciferase was measured using the Renilla luciferase kit (Promega) on a FLUOstar Omega plate reader (BMG Labtech) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Santiago-089 was extracted using the Wizard genomic DNA purification kit (Promega, USA) and sequenced at MicrobesNG (University of Birmingham ...
-
bioRxiv - Molecular Biology 2021Quote: ... Yeast genomic DNA was isolated using a Wizard Genomic DNA Purification Kit (Promega) and digested with XhoI ...
-
bioRxiv - Pathology 2021Quote: ... Total RNA extraction was performed using the SV RNA Isolation System Kit (Promega), following the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytotoxicity was quantified colorimetrically with the CytoTox96 lactate dehydrogenase (LDH)-release kit (Promega). The percentage of cytotoxicity was calculated with the formula ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). qPCR reactions of 10 µL were set up with 5 µL PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2020Quote: ... and chromosomal DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... The luciferase activities were measured utilizing the luciferase reporter assay system kit (Promega).
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega; E1910) with a 20/20 Luminometer (Turner Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... and luciferase assay performed using a dual luciferase chemiluminescence detection kit (Promega #E1910) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Levels of accumulated cAMP were detected with the cAMP-Glo™ kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... activity of both reporters was measured using the Dual-Luciferase Reporter kit (Promega) and read on a Tecan Infinite 200 PRO Reader ...
-
bioRxiv - Immunology 2022Quote: RNA was first reverse-transcribed to cDNA using GoScript Reverse Transcriptase kit (Promega) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and the first second PCR kits were obtained from Promega (M7122, Madison, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... and firefly luciferase activity was assayed using the Dual Reporter Luciferase kit (Promega).
-
bioRxiv - Synthetic Biology 2022Quote: ... Luciferase assay was performed using the Dual Luciferase Reporter Assay System kit (Promega). Bioluminescence was measured using CLARIOstar (BMG LABTech).
-
bioRxiv - Pathology 2022Quote: ... LDH activity in the supernatants was measured using CytoTox 96 kit (Promega, G1780) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted following the Maxwell 16 LEV Tissue RNA Kit protocol (Promega). For tissue-specific assays ...
-
bioRxiv - Biochemistry 2022Quote: ... using the Wizard® Genomic DNA Purification kit (Promega, Charbonnières-Les-Bains, France). The final pellet was resuspended in 40 μL of sterile ultra-high quality (UHQ ...
-
bioRxiv - Biochemistry 2022Quote: ... NFAT-luciferase activity was determined using Dual Luciferase Reporter Assay Kit (Promega E1910).
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was robotically extracted using the Maxwell tissue RNA extraction kit (Promega) and quantified using the Nanodrop ND-1000 UV-Vis Spectrophotometer (Nanodrop technologies ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, A1120) following the manufacturers’ guidelines and quantified using the Nanodrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: Measurement of CYP3A4 enzymatic activity was performed using the P450 Glo kit (Promega). Cells were incubate with 1:1000 luciferin-IPA in Hepatozyme complete for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was isolated using the Wizard® Genomic DNA Purification kit (Promega). Cells were resuspended in 100 μl of 50mM EDTA with 500U PlyC and incubated at 37 °C with shaking for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA isolation was performed using a Wizard Genomic DNA purification kit (Promega). Plasmid isolation was performed with GenElute plasmid miniprep kit (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: Intracellular adenosine triphosphate (ATP) levels were measured using a BacTiter-Glo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, Madison, WI) and the Quick Gene DNA whole blood kit S (Fugifilm ...
-
bioRxiv - Neuroscience 2020Quote: LDH release was determined by the colorimetric CytoTox 96 Cytotoxicity Assay kit (Promega). After BrainSpheres infection ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted carefully by Wizard® Genomic DNA Purification Kit (Promega, A1125), washed with 70% EtOH ...
-
bioRxiv - Biochemistry 2020Quote: GTPase activity assays were carried out using GTPase-Glo assay kit (Promega, V7681).
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... and the P450-Glo CYP1A2 Induction/Inhibition Assay kit (Promega, Cat. no. V8422) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... After removing the residual genomic DNA with the DNase I Kit (Promega, M6101), 500 ng of total RNA was reverse-transcribed into cDNAs using the PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Microbiology 2022Quote: ... TUNEL assay was carried out using DeadEnd Fluorometric TUNEL System kit (Promega, UK). Briefly ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Both PCR products were purified using the Wizard PCR cleanup kit (Promega, USA).