Labshake search
Citations for Promega :
2951 - 3000 of 4270 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: 50 nl of reverse transcription mix (2 mM (each) dNTP mix (Promega) and 0.8 Units Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... On odd days 30 μl of Cell TiterGlo 2 (Promega cat # G924A) was added to the remaining 40 μl culture and incubated 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mL of Halo Magne bead slurry (cat. #G7287, Promega, Madison, WI) were washed with MilliQ water and 3 CV of modified CSF-XB ...
-
bioRxiv - Biochemistry 2021Quote: ... the samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Genomics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). PCR products were separated following agarose gel electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated with 2% of the GloSensor reagent (Promega, cat. # E1290). Relative luminescence units were recorded using a SynergyMx microplate reader (Biotek) ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 50 ng/well of the psiCHECK-2 (Promega) construct using the FuGENE HD Transfection Reagent (Promega) ...
-
bioRxiv - Genetics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). The PCR amplicons were applied onto a 2% agarose gel with appropriate controls and markers.
-
bioRxiv - Microbiology 2022Quote: ... On-bead digestion was performed using sequencing-grade trypsin (2 μg; Promega) in 2 M urea in 100 mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were shortly cooled to room temperature and 2 µl LysC (Promega) added pre-diluted in ultra-pure water to 2 ng/µl and digested for 4 h at 37°C in the thermal cycler ...
-
bioRxiv - Biochemistry 2023Quote: ... and proteolysis was performed by adding either 2 μg of trypsin (Promega) or a combination of 2 μg of trypsin and 0.2 μg of LysC (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... alkylated with 2-iodoacetamide and digested with Endopeptidase Trypsin (sequencing grade, Promega) overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... and program DLR-2-INJ on a Glomax 20/20 Luminometer (Promega) with 20μl cell extract as the input.
-
bioRxiv - Microbiology 2023Quote: ... Samples were digested with 2 μg of trypsin (Promega, Madison, WI, USA) at 47°C for 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 units of calf intestinal alkaline phosphatase (Promega; M182A) at 37°C for 10 min at 1000 rpm in a Thermomixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual Luciferase assay kit and PsiCHECKTM-2 vector were purchased from Promega. Oligonucleotides were synthesized and obtained from Eurofins Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and digested for 2 hours at 50°C using Trypsin Platinum (Promega) using 1:50 Trypsin to sample ratio by mass ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated in 2 nM JF549-Halo-ligand (Cat. No. GA1110; Promega) for 15 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...
-
bioRxiv - Plant Biology 2024Quote: ... proteins were digested overnight at 37°C with 2 µg trypsin (Promega). Phase transfer surfactants (such as SLS ...
-
bioRxiv - Cell Biology 2024Quote: ... alkylated with 2-iodoacetamide and digested with Endopeptidase Trypsin (sequencing grade, Promega) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... and LgBiT-β-arrestin 2 was purchased from Promega (plasmid no. CS1603B118). For recruitment assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were examined for viability every 4 to 6 weeks with the CellTiter-Glo assay (Promega). Cell viability was measured in quadruplicates by seeding the cells (2,000 to 3,000 per well in 96-well plate) ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... then transfected with 4 μg pLZRS-GCaMP6 DNA plus 12 μl FuGENE 6 (Promega Cat. #E2691) in 800 μl of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Microbiology 2023Quote: ... then digested with 4 μL of a trypsin/Lys-C Mix (0.5 μg/uL) (Promega # V5071) using a two-step in-solution digestion overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...
-
bioRxiv - Biochemistry 2020Quote: 2.5 μg of bacmid DNA per construct obtained from amplification in DH10BacY cells were used to transfect 1 Mil Sf9 cells/per construct using Fugene transfection reagent (FuGENE HD, Promega). Virus at P0 was harvested and used to produce a stock Virus P1 solution to further infect 1 lt culture of Sf9 cells at 0.8-1 Mil/ml in SF921 medium containing Pen/Strep ...
-
bioRxiv - Biochemistry 2021Quote: ... Genomic DNA was eliminated by incubating 10 μL of isolated RNA with 1 U of RQ1 RNase-free DNase I (Promega) for 30 min at 30°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were digested overnight at 37 °C with 5 μL of trypsin (1 μg dissolved in 50 mM HEPES pH 8.0, Promega V5111). The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001) ...