Labshake search
Citations for Promega :
2951 - 3000 of 4181 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:3 with 50 mM HEPES pH 8.5 and then digested by a 1:50 (trypsin to protein) ratio of sequencing grade modified trypsin (Promega) for 16 hours at 600 rpm and 25°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins captured on the columns were then digested by adding 20 μL of digestion buffer (50 mM TEAB, pH 8.5) containing 1 μg of sequencing grade trypsin (Promega) 1 hour at 47
-
bioRxiv - Immunology 2023Quote: ... RH5ΔNC-specific B cells were identified as live CD19+ IgG+ RH5ΔNC-APC+ RH5ΔNC-PE+ cells and single cell sorted into 96-well plates containing 10µL/well lysis buffer (10mM Tris [T3038, Merck], 1 unit/mL RNasin Ribonuclease Inhibitor [N2515, Promega]) and frozen at -80 °C.
-
bioRxiv - Biochemistry 2023Quote: Cells stably expressing epitope-tagged NK1R were transiently transfected (Lipofectamine™ 3000 Transfection Reagent) with 1 μg of pGL4.29[luc2P/CRE/Hygro] or pGL4.30[luc2P/NFAT-RE/Hygro] plasmids (Promega Corp.), seeded in a white-walled 96-well flat clear bottom plate (Corning #3610) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were washed once in PBS and lysed in 35 μL 1× Luciferase Cell culture lysis buffer (E1531, Promega) for 15 min at room temperature and centrifuged for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... PB-CAG-H2B-mCherry-IPuroR and pCMV-hyPBase were co-transfected into KhES-1 using Fugene 6 (Promega, E269A) transfection reagent following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: Digoxigenin-labelled antisense riboprobes were synthesized from cloned cDNA fragments (Supplementary file 1) using T7 or SP6 polymerases (Promega) and digoxigenin-labelled dUTPs (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... in TBS-T followed by a washing step for 30 min with TBS-T and a final 60 min incubation with with 1:10.000 horseradish peroxide-conjugated anti-rabbit IgG (Promega) in TBS-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 ng pCas9 mCherry Frame +1 and 100ng pCRISPaint HaloTag-Puro donor plasmids were transfected using ViaFect (Promega E498A). Three days post-transfection cells were sub-cultured into media supplemented with puromycin (0.8 µg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... various concentrations of the compounds were mixed with 1 - 2 nM sensor and 1,000-fold diluted furimazine (Nano-Glo Luciferase Assay Substrate, Promega) in 100 μL of buffer (50 mM HEPES ...
-
bioRxiv - Biochemistry 2023Quote: ... Trypsin digestion was performed using a trypsin solution with a concentration of 1 μg /μL (Trypsin Gold, V528A, Promega), and 0.6 μL of the trypsin solution was added to achieve a final ratio of 1:50 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.05% (v/v) NP-40 and 0.5% (v/v) Triton X-100) containing 20 U ml−1 of RNasin (Promega), 1 mM DTT ...
-
bioRxiv - Cell Biology 2024Quote: ... reduced (6.5mM DTT, 1 hour at 60°C), alkylated (54mM Iodoacetamide, 30min, RT) and digested with 1µg of Trypsin (Promega) (96) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were stained with 1 nM Halo Tag Ligand (HTL) tagged with Janelia Fluor 646 (HTL-JF646, Promega, #GA1110) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The sample was processed according to the SP3 protocol36 and digested overnight with trypsin (Promega, enzyme/protein 1:50). Peptides were desalted using SBD-RPS tips as previously described37 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell content was measured on Days 1-6 using Cell Titer-Glo Luminescent Cell Viability Assay (Cat# G7570, Promega). Luminescence was measured at an integration time of 0.5 second per well ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing the promoter region of spia-1 (1.23 kb upstream from the start ATG) and the entire genomic region into the pGEMT vector (Promega). A transcriptional construct (pSO22) ...
-
bioRxiv - Plant Biology 2024Quote: ... The alkylation was stopped by the addition of 1 µl of 200 mM cysteine and the samples digested overnight with 1 µl of 0.5 µg/μl trypsin (MS Gold, Promega). The resulting peptides were desalted and subsequently analysed on UltiMate™ 3000 RSLCnano System connected to LTQ Orbitrap Velos mass spectrometer (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µL of Nano-Glo Luciferase Assay Reagent (1:50 mixture of Nano-Glo Luciferase assay substrate:Nano-Glo Luciferase assay buffer (Promega) was added to each well containing the diluted samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL and 25 µL of the trypsin solution (100 ng µL-1 of trypsin sequencing grade from Promega) were added to EV and WC samples ...
-
bioRxiv - Microbiology 2024Quote: ... Each sample was treated with 1 μL of trypsin solution (0.5 μg/μL Sequencing Grade Modified Trypsin, Porcine (Promega) in 0.1 mM HCl) ...
-
bioRxiv - Microbiology 2024Quote: Viral loads were quantified as previously described [25] using the GoTaq® Probe 1-Step RT-qPCR System (Promega). The IAV primers and probe sequences are published as part of the CDC IAV detection kit using the following primers F ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by a 4-fold dilution with 50 mM HEPES buffer pH 8.5 and overnight trypsin digestion (50:1 protein: enzyme by weight, Promega) at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Digestion buffer (50 mM TEAB pH 8.0) containing sequencing-grade modified trypsin (1/25, w/w; Promega, Madison, Wisconsin) was added to the S-trap column and incubate for 2h at 47 °C ...
-
bioRxiv - Genetics 2024Quote: ... YFP-negative first instar larvae of the progeny of gwnull- 1/PBac(681.P.FSVS-1)PMCACPTI001995 or gwnul1-2/PBac(681.P.FSVS-1)PMCACPTI001995 were collected 38 hr after egg laying and were lysed in Passive lysis buffer (Promega). After centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... At 8 and 24 hpt monolayers were lysed with 100 μl 1 x passive lysis buffer according to the manufacturer’s instructions (Promega), stored at −80°C and analysed using Dual-luciferase substrate (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was prepared from 1 μg of total RNA using Random Primers and M-MLV Reverse Transcriptase (both Promega). Primers were allowed to bind to template RNA for 5 minutes at 70°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein digestion was done overnight at room temperature with trypsin (Promega V5113, 1/100 volume of 1mg/mL trypsin). 1% final concentration of TFA was added to quench the digestion ...
-
bioRxiv - Genomics 2024Quote: In total 120k nuclei were sorted using an SH800 sorter (Sony) into 87.5μl of collection buffer (1 U/µl RNAsin (Promega, N2515), 5% fatty acid-free BSA (Proliant ...
-
bioRxiv - Genetics 2024Quote: ... Membranes were probed with a 1:2,000 dilution of anti Phospho-Ser23/24 TnI antibody (Cell Signalling) and 1:6,000 diluting of anti- rabbit-HRP secondary (Promega). Loading controls following antibody stripping with Restore Plus reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reaction was incubated for 60 minutes at 30°C and stopped by the addition of 1 reaction volume (10µL) of 5X PLB dilute to 2X in water (Promega). Firefly luciferase was then assayed on the Synergy HTX plate reader (BioTek ...
-
bioRxiv - Microbiology 2024Quote: A PCR product encoding SARS Cov-2 macrodomain residues 1 to 176 was cloned into the HindIII and XhoI restriction sites of the pBIT3.1-C vector(Promega) which has an C-terminal 11 amino acid HiBiT tag.
-
bioRxiv - Biochemistry 2024Quote: ... Colonies were pooled with LB and samples were diluted to an OD600 of ∼4.0 and 1 mL of concentrated cells underwent genomic DNA preparation using the Wizard Genomic DNA Purification Kit (Promega). DNA was quantified using the QuantiFluor ONE dsDNA System (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... Each library was diluted to an OD600 of ∼4.0 and 1 mL of concentrated cells underwent genomic DNA preparation using the Wizard Genomic DNA Purification Kit (Promega). DNA was quantified using the QuantiFluor ONE dsDNA System (Promega) ...
-
bioRxiv - Biophysics 2024Quote: Tracking was performed in Human Bronchial Epithelial Cells (HBEC) labeled with between 0.5 pM – 1 pM JF646 dye (Promega). At this concentration of dye ...
-
bioRxiv - Cancer Biology 2024Quote: PANC-1 cells were prepared as described previously (14) and ApoTox-Glo triplex assay kit (Promega, WI, USA, G6320) was used according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2024Quote: ... was added to 0.5 mL 1% bovine serum albumin (BSA) in IP/lysis buffer (Pierce, 87788) and incubated with MagneHis beads (Promega, 32 µL suspension ...
-
bioRxiv - Cancer Biology 2024Quote: ... Trypsin/LysC proteolysis was performed in 100µL 50mM ABC (pH 8) by adding Trypsin/LysC (Promega, 1:50 ratio) to precipitated EV proteins and incubated at 37°C overnight (∼20h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...