Labshake search
Citations for Promega :
251 - 300 of 5634 citations for Retinol Binding Protein RBP Multi format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Proteins were first digested for 5 h at 37 °C with 500 ng rLys-C Mass Spec Grade (Promega, Madison, WI, USA) before being diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration below 2 M urea ...
-
bioRxiv - Systems Biology 2022Quote: ... 102.2 µL of 100 mM ABC was added and proteins were digested for 16 hours at 37°C using 5 µg of trypsin (dissolved in trypsin resuspension buffer, Promega, Walldorf, Germany). Tryptic digestion was stopped by addition of 2.5 µL 100% formic acid ...
-
bioRxiv - Systems Biology 2022Quote: ... 102.2 µL of 100 mM TEAB was added and proteins were digested for 16 hours at 37°C using 5 µg of trypsin (dissolved in trypsin resuspension buffer, Promega, Walldorf, Germany). Tryptic digestion was stopped by addition of 2.5 µL 100% formic acid ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cells were lysed and the luciferase activities of Photinus pyralis and Renilla reniformis were measured using a GloMax®-Multi luminometer (Promega), following the instructions of the Dual-luciferase reporter assay system (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... The luciferin is then utilized in a firefly luciferase reaction to generate a bright luminescent signal determined as RLUs using a GloMax-Multi Detection System: Luminometer (Promega, USA). 2/ Colorimetric detection of senescence-associated β galactosidase following the manufacturer’s protocol (Cell Signaling #9860) ...
-
bioRxiv - Genetics 2021Quote: ... Development and stop solutions were added followed by detection of absorbance at 450 on a Luminometer: GloMax-Multi Detection System (Promega, USA).
-
bioRxiv - Synthetic Biology 2023Quote: ... Crude extract (10 μl) was mixed with 40 μl of LARII and FLuc activity was determined using a GloMax®-Multi Detection System (Promega) with a 2 s delay and a 10 s integration times ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated 3 h at 37°C and alkaline phosphatase (SEAP) activity determined measuring the absorbance at 600 nm using GloMax®-Multi Detection System (Promega).
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 5× Gotaq buffer (Promega M792A), 1μl of 10μM forward primer ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed on the plate and incubated with luminescence glo regents per the luminescence glo assay kit’s instructions (Promega). Luminescence was recorded using a BioTek Synergy2 plate reader.
-
Psi promotes Drosophila wing growth through transcriptional repression of key developmental networksbioRxiv - Developmental Biology 2020Quote: ... 5 µL of RNA was used for each cDNA synthesis (GoScript™ Reverse Transcription System kit, Promega). qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... Luminescence was measured using a plate reader (Promega, GloMax Discover plate reader, GM3000). Relative viability was calculated by dividing luminescence values for each replicate by mean luminescence of media control for each experiment.
-
bioRxiv - Cancer Biology 2022Quote: ... Immunoprecipitated protein–DNA complexes and 5% input were analyzed by qRT-PCR using GO taq QPCR master mix (Promega, A6002, lot no. 0000385100) in triplicate using primers specific for PFKFB3 HREs ...
-
bioRxiv - Cell Biology 2022Quote: ... [35S]-methionine-labelled proteins were transcribed and translated using a TnT™ coupled transcription–translation kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: GTPase activity of the purified protein was measure using the Promega GTPase-Glo™ kit (Promega, V7681), as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and luciferase/Renilla signal was quantified on a GloMax®-Multi+ dual injector luminometer using a Dual-Glo® Luciferase Assay system (Promega). To determine the effect of increasing the amount of Tbx2a co-transfected on luciferase expression we transformed the measure of luciferase/Renilla for each co-transfected reaction relative to the average measure of luciferase/Renilla of the same plasmid that was not co-transfected with Tbx2a ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The resulting formazan precipitate was then dissolved by addition of 100 μL DMSO and quantified spectrophotometrically at 560nm using the GloMax Multi Microplate Multimode Reader (Promega, Madison, USA). Cell viability was expressed as a percentage relative to the negative control of untreated cell samples.
-
bioRxiv - Immunology 2021Quote: ... and bacterial bioluminescence was measured every 24 h for up to 120 h with a GloMax Multi Detection System (Promega, Madison, WI). For the M.tb replication rate experiment ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... post-injection using a Synergy HTX Multi-mode Microplate Reader (Bio Tek Instruments, Winooski, VT) and the Nano-Glo Dual Luciferase Reporter System (Promega, Madison, WI) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annexin V binding to PS was measured using the RealTime-Glo™ Annexin V luminescence assay (#JA1000; Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read with a plate reader (GloMax® Discover Microplate Reader (Promega) or CLARIOstar Plus Microplate Reader (BMG Labtech) ...
-
bioRxiv - Biochemistry 2019Quote: ... The luminescence signal was developed for 20 min after adding 40 µl kinase detection reagent (kit) and measured with a GloMaxMulti plate reader (Promega). The average of three experiments performed in duplicate and normalized to PI3KC3-C1 activity were determined ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were seeded in 96 wells plate and luciferase activities were measured using Dual-Luciferase Reporter Assay System kit as described by the manufacture (Promega). Fluc/Rluc ratios were determined as relative luciferase activities.
-
bioRxiv - Cancer Biology 2022Quote: ... for 72 hours and cell proliferation was assayed using the CellTiter 96 Non-Radioactive Cell Proliferation kit and a GloMax Discovery plate reader (Promega). For proteomic mass spectrometry ...
-
bioRxiv - Biochemistry 2023Quote: Cells were grown in opaque 96-well white plates and then processed according to the manufacturer’s instructions of the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega # G9241). The standard curve of ATP was determined in parallel for absolute quantitation.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from overnight cultures on GCB agar plates with appropriate components using Wizard Genomic DNA purification kit (Promega) following manufacturer instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lactate assay was performed using 5 μl of media and the luminometric Lactate-Glo assay kit (Promega, # J5021) according to the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Subsequent measurements were taken every 24 hrs for 5 days using CellTiterGlo Luminescent Cell Viability Assay kit (Promega) and SpectraMax plate reader (Molecular Devices ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized to mock-treated ...
-
bioRxiv - Microbiology 2023Quote: ... and GloMax plate reader (Promega). Data were normalized by subtracting Gluc signal from mock-infected cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Luciferase activity was analyzed using the Dual-Luciferase® Reporter Assay System and read with GloMax®-Multi Detection System (Promega, Madison, WI).
-
bioRxiv - Genomics 2019Quote: ... 35S labeled proteins were synthesized in vitro using the TNT T7 Quick for PCR DNA kit (Promega, L5540). Labeled proteins were incubated with MBP-tagged proteins in TNEN50 (50mM Tris pH7.5 ...
-
bioRxiv - Microbiology 2021Quote: ATPase activity of the purified proteins was determined using two kits – Enliten ATPase assay (FF2000, Promega, Moscow, Russia) and malachite green phosphate assay (MAK307 ...
-
bioRxiv - Cell Biology 2019Quote: ... In vitro translated (IVT-) proteins were synthesized using a TNT quick-coupled transcription-translation kit (Promega, Madison, WI). For synthesizing the Pav and PavDEAD proteins ...
-
bioRxiv - Cell Biology 2023Quote: 35S-radiolabeled Tom40 precursor proteins were synthesized in vitro using the TNT Quick Coupled Transcription/Translation kit (Promega). Transcripts for MCO6 encoding 3 additional N-terminal methionine residues for radiolabelling of the Mco6 protein which lacks internal methionine residues ...
-
bioRxiv - Microbiology 2020Quote: ... After washing with 150 μL of binding buffer four times the samples were subjected to proteolytic digestion using 1.2 μg trypsin (sequencing grade, Promega) for 2h at 47°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Physiology 2023Quote: The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which the plate is read for luciferase signal using GloMax Explorer Plate Reader (Promega). For each ratio (CAR-T ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read at a wavelength of 450nm with a Glomax plate reader (Promega). Toxin concentration in each sample was calculated using the standard curve and normalized by the optical density of the culture ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Molecular Biology 2021Quote: The pGL-AP-1 plasmid containing 6 consensus AP-1 binding sites was co-transfected with the pRL-CMV plasmid (Promega) into cells using TransIT 2020 transfection reagent (Mirus Bio ...
-
bioRxiv - Molecular Biology 2021Quote: The minimal CYC1 promoter with seven tetracycline binding sites was amplified from the yeast Tet-Promoters collection35 with YG4866/YG4867 and cloned into pGEM-Teasy (Promega) to create pCB4695 ...
-
bioRxiv - Microbiology 2020Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega) resulting in the NoV-GII plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...