Labshake search
Citations for Promega :
251 - 300 of 968 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM L-Glutamin and 250 μM Luziferin D (Promega, Madison, USA). Cells were incubated 12-16 hours in a humidified incubator at 37°C and 5% CO2 to adhere to the bottom of the plate ...
-
bioRxiv - Microbiology 2023Quote: ... Biotin-oligo d(T) (Promega, #Z5261, 0.2 μmol/L for mRNA FISH); Diethyl Pyrocarbonate (DEPC)-treated water (Invitrogen™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase 3/7 activity was measured 24 hours post-cytokine treatment using the Caspase-Glo® 3/7 Assay System (Promega, #G8090).
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: To determine Caspase 3/7 activity in THP-1 SAMHD1 KO and CTRL cells the Caspase-Glo 3/7 assay (Promega, Walldorf, Germany) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability and caspase 3/7 activity were evaluated using CellTiter-Glo and Caspases-Glo 3/7 assays (both from Promega, Madison, WI), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was quantified in cell culture by using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Biochemistry 2019Quote: ... N-glycans were released from the membrane-bound protein using 2 U PNGase F (Promega, WI, USA) with overnight incubation at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid for β-arrestin-2 fused at the N-terminus to LgBiT was obtained from Promega custom assay services (plasmid CS1603B118) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 µL/well of Caspase 3/7 reagent (Promega) was added per the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Cancer Biology 2019Quote: ... named Caspase-Glo® 3/7 assay (G8091, Promega). The assay was performed following the manufacturer’s protocol in white polystyrene 96-well plates (Nunc ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the Caspase-Glo® 3/7 assay (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 Assay System (Promega, Cat. G8091) was used to measure the activity of caspase-3 and caspase-7 ...
-
bioRxiv - Cancer Biology 2023Quote: The Caspase-Glo® 3/7 Assay System (Promega), a luminescence-based assay for detection of active caspase-3 and 7 ...
-
bioRxiv - Cell Biology 2023Quote: Promega’s Capsase-Glo 3/7 Assay kit (G8093, Promega) was used to measure caspase activity according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Caspase-Glo 3/7 Assay System (Promega, cat # G8091) was used to quantify activated cellular caspase 3/7 per manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptosis was measured using Caspase-Glo 3/7 (Promega). Early apoptosis and late apoptosis/necrosis were measured using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: Induction of apoptosis after 24 h of doxorubicin treatment was quantified by analyzing Caspase 3/7 activity using the Caspase-Glo® 3/7 3D assay (Promega, Madison, WI). The assay protocol was followed from the manufacturer’s website ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Biochemistry 2023Quote: ... MTS ([3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (#G3581) was purchased from Promega (Charbonnières-les-Bains, France).
-
bioRxiv - Neuroscience 2020Quote: Transfected neuronal cultures with the NF-κB reporter Firefly Luciferase plasmid (Cat. N° E1980, Promega, Madison, WI, USA), were stimulated with NMDA/glycine for 60 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... NanoBiT plasmids pBiT1.1-N_[TK/SmBiT] and pBiT2.1-N_[TK/LgBiT] were purchased from Promega (cat n° N2014).
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were digested overnight at 37 °C with 6 ng μL-1 of Asp-N (Promega, UK). Peptides were extracted in 2 % v/v formic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... The N-terminal 312 aa Halo tag sequence was PCR amplified from His6HaloTag® T7 Vector pH6HTN (Promega) as a 5’ SpeI ...
-
bioRxiv - Molecular Biology 2020Quote: ... 300 ng CBS-VN (venus N-terminal) and 200 ng pmCherry-C1 plasmids) by using Fugene HD (Promega). At 24 h post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:50 ...
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Cell Biology 2024Quote: ... This cDNA was assembled into a vector encoding N-terminal fusion to the HaloTag (pHTN_HaloTag_CMV-neo, Promega G7721) using restriction cloning ...
-
bioRxiv - Biophysics 2023Quote: ... equal volumes of HiBiT-N VLPs and hACE2-LgBiT EVs were mixed with nanoluc substrate (cat#N2420, Promega) and trypsin (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega) by PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... A two-stage enzymatic digestion with 2 hr lysyl endopeptidase (FUJIFILM Wako Chemicals U.S.A. Corporation) and o/n trypsin (Promega) was then performed to generate the crosslinked peptides.
-
bioRxiv - Biophysics 2019Quote: ... Eight-repeats of protein L were inserted into a modified pFN18a vector (Promega), which introduces a HaloTag at the N-terminus and a SpyTag at the C-terminus ...