Labshake search
Citations for Promega :
251 - 300 of 1140 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT7-IRES His-T7-HCF-1VIC was in vitro transcribed/translated using the TnT Quick Coupled Transcription/Translation System (Promega, Madison, Wisconsin, L1171). Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001) ...
-
bioRxiv - Microbiology 2021Quote: ... The linearized vector and the slpMh-6x His fragment were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany) and assembled via isothermal in vitro ligation according to Gibson et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-HaloTag (Promega, G9211); rabbit anti-CIMPR (made in house) ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-Tag (Promega, G9211, mouse), and HSP90 (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2024Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase 3/7 activity was measured 24 hours post-cytokine treatment using the Caspase-Glo® 3/7 Assay System (Promega, #G8090).
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: To determine Caspase 3/7 activity in THP-1 SAMHD1 KO and CTRL cells the Caspase-Glo 3/7 assay (Promega, Walldorf, Germany) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability and caspase 3/7 activity were evaluated using CellTiter-Glo and Caspases-Glo 3/7 assays (both from Promega, Madison, WI), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was quantified in cell culture by using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... IL-12 and TNFα were analyzed by semiquantitative PCR (SYBR Green assay Go Taq qPCR Master Mix; Promega) with specific primers (Metabion ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 µL/well of Caspase 3/7 reagent (Promega) was added per the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Cancer Biology 2019Quote: ... named Caspase-Glo® 3/7 assay (G8091, Promega). The assay was performed following the manufacturer’s protocol in white polystyrene 96-well plates (Nunc ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the Caspase-Glo® 3/7 assay (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2023Quote: The Caspase-Glo® 3/7 Assay System (Promega), a luminescence-based assay for detection of active caspase-3 and 7 ...
-
bioRxiv - Cell Biology 2023Quote: Promega’s Capsase-Glo 3/7 Assay kit (G8093, Promega) was used to measure caspase activity according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Caspase-Glo 3/7 Assay System (Promega, cat # G8091) was used to quantify activated cellular caspase 3/7 per manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 Assay System (Promega, Cat. G8091) was used to measure the activity of caspase-3 and caspase-7 ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: Induction of apoptosis after 24 h of doxorubicin treatment was quantified by analyzing Caspase 3/7 activity using the Caspase-Glo® 3/7 3D assay (Promega, Madison, WI). The assay protocol was followed from the manufacturer’s website ...
-
bioRxiv - Biochemistry 2023Quote: ... MTS ([3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (#G3581) was purchased from Promega (Charbonnières-les-Bains, France).
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... Proteins were expressed from the pcDNA™3.1/His construct by the TNT® T7 Quick Coupled Transcription/Translation kit (Catalog #L1170, Promega Co., Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: IL-18 truncations were generated through in vitro transcription/translation using pET-pro-IL-18 as a template in 10 µl reaction volumes following the manufacturer’s recommendations (TNT Coupled Reticulocyte Lysate; Promega) as previously [40] ...
-
bioRxiv - Cell Biology 2019Quote: ... α-mouse IgG HRP conjugate (Promega W4021) were used as secondary antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-βIII-tubulin (G712A; Promega), rabbit anti-Cdc42 (07-1466 ...
-
bioRxiv - Plant Biology 2020Quote: ... a rabbit-anti-mouse-IgG (Promega) coupled with an alkaline phosphatase was used.
-
bioRxiv - Cancer Biology 2021Quote: ... Lumit anti-mouse antibody-LgBiT (Promega) and Lumit anti-rabbit antibody-SmBiT (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-ßIII tubulin (Promega, G7121); mouse anti-NDUFA9 (abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-LacZ (1/1000; Promega), mouse anti-βPS (1/10 ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-β-galactosidase (Promega, Z378B) 1:1000 ...