Labshake search
Citations for Promega :
251 - 300 of 3626 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Human normal genomic DNA was obtained from Promega (Madison, WI, USA) and the values are averages of three replicates ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... in a background of 130ng of normal human genomic DNA (Promega) was used as a positive control ...
-
bioRxiv - Cell Biology 2019Quote: ... and human samples were performed using GoTaq green master mix (Promega) and the following amplification conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 830bp or 800bp human STIM1 promoter into pGL3 basic vector (Promega) between XhoI and HindIII ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized with primers specific for each strand separately at 50 °C (Supplemental Table S1) using the ImProm-II™ Reverse Transcription System (Promega, A3800) and subjected to qPCR with primers specific for the viral N-protein (Supplemental Table S1).
-
bioRxiv - Systems Biology 2020Quote: ... albicans as well as of a commercially available human protein digest (Promega), which was exclusively used in this experiment ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 ng/mL recombinant human basic fibroblast growth factor (bFGF, Promega) then centrifuged ...
-
bioRxiv - Biochemistry 2023Quote: MS-Compatible Human Protein Extract Digest (K562) was purchased from Promega (V6951), MassPREP E ...
-
bioRxiv - Cell Biology 2023Quote: ... human BLTP2/KIAA0100 ORF was amplified from pFN21A-Halo-KIAA0100 (FHC00016, Promega). An unstructured linker (sequence ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products amplified by gene-specific RT-qPCR primers listed in Supplemental Table S1 were cloned in pGEM-T Easy vector (Promega, Madison, Wisconsin, USA) prior to their sequencing ...
-
bioRxiv - Pathology 2020Quote: ... The partial sequence encoding the nucleoprotein from HPWMoV was amplified using specific primers (Table 1) from two-fold diluted cDNA with GoTaq® Flexi DNA polymerase (Promega, WI, USA) with the following reaction conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Immunology 2024Quote: ... One μg PCR product was used as the specific-template for synthesizing of dsRNA in vitro by using the T7 Ribomax Express RNAi System (Promega, Madison, WI, USA). The concentration of dsRNA was quantified at 280 nm using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific Inc.) ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Genomics 2022Quote: ... The primers were commercially synthesized (IDT) and tested on human genomic DNA (Promega) to confirm generation of only one amplicon product at the expected size ...
-
bioRxiv - Genetics 2020Quote: ... Deidentified healthy donor DNA was obtained from Promega (Human Genomic DNA: Female, G152A). DNA from ALS cases (ND11836 and ND13803 ...
-
bioRxiv - Cancer Biology 2020Quote: 2000bp human lncRNA-TANAR(ENST00000425110.1) promoter was cloned into PGL3 basic vectors (Promega). By mutating the crucial site of AR binding site in the lncRNA-TANAR 5’ promoter to EcoRI cutting site (-GAATTC) ...
-
bioRxiv - Immunology 2022Quote: Human LRBA was cloned in seven different fragments into pCIneo FLAG vectors (Promega). These plasmids were kindly provided by Dr ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Neuroscience 2021Quote: ... All animals were genotyped according to the MMRRC strain-specific primers and protocols using GoTaq Green PCR master mix (Cat. No. M712, Promega Corporation, Madison, WI, USA).
-
bioRxiv - Neuroscience 2022Quote: ... All animals were genotyped according to the MMRRC strain-specific primers and protocols using GoTaq Green PCR master mix (Cat. No. M712, Promega Corporation, Madison, WI, USA).
-
bioRxiv - Molecular Biology 2019Quote: ... and human 293T cells as producer cells using the FUGENE HD transfection reagent (Promega), as described [50] ...
-
bioRxiv - Pathology 2019Quote: ... human primary aortic SMCs were transfected with pGL4.34 Vector plasmids (E1350; Promega, Madison, WI) using Effectene Transfection Reagent (301425 ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... we used a 1/1500 artificial mix of promastigote DNA and human DNA (Promega) to reflect the median ratio found in clinical samples ...
-
bioRxiv - Neuroscience 2022Quote: Open reading frames of human OR genes were subcloned into pCI (Promega, WI, USA) with a Rho-tag (the sequence encoding the first 20 amino acids of rhodopsin ...
-
bioRxiv - Immunology 2023Quote: ... tailed with complete TRAC and TRBC1 gene segments amplified from human genomic DNA (Promega), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviral packaging vectors into human HEK-293T cells via calciumphosphate transfection (Promega; Madison, WI, USA), according to manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human SMARCB1 was translated in vitro using TNT Quick Coupled Transcription/Translation System (L1170, Promega). 1 µg of pcDNA3.1-FLAG-SMARCB1 was incubated at 30°C for 90 minutes with 20 µM methionine and TNT T7 Quick Master Mix ...
-
bioRxiv - Bioengineering 2021Quote: The open reading frame for human SOX17 was PCR amplified using GoTaq Master Mix (Promega) from the PB-TRE3G-SOX17 plasmid (Table S5) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Genetics 2022Quote: ... human POPDC1 and POPDC2 cDNA sequences were cloned into the pFC14K or pFC32K plasmids (Promega), which contain C-terminus sequences for HaloTag and NanoLuc tags ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl of 7.5×104 Jurkat effector cells expressing either human FcγRIIIa or murine FcγRIV (Promega) resuspended in assay buffer were added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length human RNU6 sequence (110 nucleotides) was amplified by PCR and cloned into psiCHECK2 (Promega), downstream of Renilla luciferase ...
-
bioRxiv - Cancer Biology 2020Quote: ... Standards for quantification were created by serial dilution of pre-quantified BSC human male DNA (Promega). Amplification reactions were performed in duplicate using 96 well-plates using a CFX96 Touch Real-time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: The region of interest (750-850 bp) was PCR amplified from pooled male human DNA (Promega) and cloned into a STARRseq luciferase validation vector_ORI_empty plasmid (Addgene plasmid #99298 ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Bioengineering 2020Quote: ... and detected with anti-rabbit or anti-human HRP-conjugated secondary antibodies (Promega W4011 and W4031). Blots were developed using ECL (ThermoScientific 32106 ...
-
bioRxiv - Immunology 2023Quote: ... 100 μl of 5,000-fold diluted Peroxidase AffiniPure goat anti-human IgG (H+L) antibody (Promega) was added into each well and incubated for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega). All mutated plasmids were constructed from wild type plasmids by Fast Mutagenesis System (TransGen Biotech) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10mM Ultrapure ATP and 0.7 μg of recombinant full-length human CDC7/DBF4 kinase (Promega, V5088). Reactions were incubated at 37 °C for 120 min and then terminated by freezing on dry ice before mass spectrometry.
-
bioRxiv - Immunology 2024Quote: ... 3×106 ADCC and ADCP Bioassay Effector Cells expressing the human FcγRIIIa or FcγRIIa receptors (Promega) were added per well and the cells were incubated in at 37°C with 5% CO2 for 6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: Kit (Promega). For transposition with an additional plasmid pCas12k ...
-
bioRxiv - Cancer Biology 2021Quote: Each enhancer or promoter region was amplified from human genomic DNA and cloned into pGL4.10 [luc2] (Promega) containing a SNP (rs718960 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCMVΔ8.9 plasmids were co-introduced into human embryonic kidney 293T cells using the FuGENE reagent (Promega). 48 h after transfection ...