Labshake search
Citations for Promega :
251 - 300 of 679 citations for Eukaryotic Peptide Chain Release Factor GTP Binding Subunit ERF3A GSPT1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the proteins were digested into tryptic peptides by incubation with 1□µg sequencing grade trypsin (Promega) overnight at 37□°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The trophocidal activity of cyclic peptides was assessed using the CellTiter-Glo 2.0 (Promega, Madison, WI) luminescent viability assay as previously described.9,11 In brief ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Cancer Biology 2024Quote: ZEB1 3′UTR region with mitomiR-3 binding site was cloned into pmirGLO-Dual Luciferase miRNA target expression vector (Promega, USA) for miRNA luciferase reporter assay (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... was removed and diluted into LDH Storage Buffer at a dilution factor of 1:100 although the dilution factor can vary depending on the amount of cells and the presence of serum in the medium (Promega). LDH activity was measured by adding an equal volume of LDH Detection Reagent (50 µL ...
-
bioRxiv - Microbiology 2021Quote: Peptides from cell-surface/biofilm-ECM-associated proteins were released via a Trypsin/Lys-C mix (Promega) at a final concentration of 50 ng µL-1 ...
-
bioRxiv - Neuroscience 2023Quote: A pET25 vector encoding the cell penetrating peptide SynB1 underwent restriction digest using BamHI (Promega, catalog #R6021) for 1 hour at 37 °C and SfiI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The C terminus of rat Gβ1 was linked to peptide 86 subunit16,17 (also named as HiBiT, Promega) with a 15-amino acid polypeptide (GSSGGGGSGGGGSSG ...
-
bioRxiv - Cell Biology 2020Quote: ... and the sequence encoding a genetically modified firefly luciferase into which a cAMP-binding domain has been inserted from the pGloSensor-20F (Promega, Cat #E1171).
-
bioRxiv - Cancer Biology 2020Quote: The wild-type 3’UTR region of SALL4 mRNA or a mutant without the miR-205 binding site (Figure 4E) was amplified using PCR and cloned into the pGL3 vector (Promega, Madison, USA). HEK 293T cells were seeded into 24-well plates ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...
-
bioRxiv - Neuroscience 2024Quote: ... stable cell line expressing the human MC4-R and a split luciferase cAMP genetic sensor based on the circularized fusion of firefly luciferase and protein kinase A regulatory cAMP binding domain (clone 22F, Promega, Madison WI) was used to determine the α-MSH-elicited cAMP responses in live cells as previously described 32 ...
-
bioRxiv - Genetics 2024Quote: ... 13ng of pCMV-VP16 (EV) or pCMV-LXRα-VP16 and 13 ng of GAL4-Co-factor vector and 13ng of pRL-TK (Promega, 2241) using Lipofectamine 3000 ...
-
bioRxiv - Biochemistry 2021Quote: ... Aliquots of reagent were used for sample labeling of a serial dilution of K562 peptide digest standard (Promega) using all heavy N labeled channels that day following manufacturer instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Plant Biology 2023Quote: ... Total proteome peptide pools were generated by sample digestion overnight with 1:100 sequencing grade trypsin (V5113; Promega). Generated peptide pools were quantified by Nanodrop ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptide digestion was performed by adding 1µg of trypsin (Trypsin Gold, Mass Spectrometry Grade, Promega Corporation, WI, USA) and incubating each sample overnight at 30°C ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were then digested into peptides by the addition of 1:1000 (g/g) Lys-C Protease (Promega) for 4 h at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... or mutant type (MT) and KCNQ1OT1 binding sites were synthesized and replicated onto a pGL3 Dual□luciferase Target Vector (Promega, Madison, WI, USA), to create Wild Type and Mutant Type let-7a-5p plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... of SNHG16 sequence and the 3’-untranslated region (UTR) fragment of STARD9 containing miR-1301-3p binding site were subcloned into the pmirGLO vectors (Promega, Madison, WI, USA) to generate SNHG16-Wt/Mut vectors and STARD9-Wt/Mut vectors ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... pertussis towards HeLa and HEK-Cas9 was determined as changes in cell membrane integrity using the fluorescent DNA binding dye CellTox Green (Promega, Cat. No. G8743), as described previously (29) ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... The mixture was then incubated with 1 μg of AKT substrate II peptide (CKRPRAASFAE) as the Pak4 substrate (Promega) or 1 μg of GST-Raf13 as the Pak1 substrate with a total volume of 5 μL in a 384-well plate (PerkinElmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... EV protein samples were alkylated the next day with 50 mM iodoacetamide for 2 hours at ambient temperature in the dark and then digested into peptides with 1.2 µg proteomics-grade trypsin/LysC (Promega) according to the SP3 protocol described by Hughes et al (2019) ...
-
bioRxiv - Physiology 2022Quote: ... The proteins were cleaved into tryptic peptides by addition of 25 μl of a 0.2 μg/μl trypsin (Promega) in 50 mM ammonium bicarbonate and incubation (18 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality control of the instrument setup was monitored using the Promega 6x5 LC-MS/MS Peptide Reference Mix (Promega) and analyzed with the PReMiS software (version 1.0.5.1 ...
-
bioRxiv - Biochemistry 2023Quote: Serine/threonine phosphatase activity assay of PP2A was performed using the artificial p-peptides RRA(pT)VA substrate (Promega) in lysis buffer containing 1 mM MnCl2 at 70 °C 26 ...
-
bioRxiv - Systems Biology 2024Quote: ... The digested samples were combined with 5 μL of 6 x 5 LC-MS/MS Peptide Reference mix (Promega) and stored at-20℃ until analysis.
-
bioRxiv - Microbiology 2021Quote: ... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
bioRxiv - Systems Biology 2021Quote: ... Collisional energy was ramped stepwise as a function of ion mobility.24 Peptide loading was normalized to the total ion chromatograms from 200 ng injections of K562 whole cell lysate standard (Promega).
-
bioRxiv - Biophysics 2020Quote: ... Proteins were digested to peptides by addition of 25 μl of 50 mM ammonium bicarbonate containing 5 μg of trypsin (Promega) and incubating (37°C ...
-
bioRxiv - Immunology 2020Quote: The strategy for genome-engineering to tag HLA-B with the HiBit peptide was developed based on a previous publication from Promega Corporation ...
-
bioRxiv - Cell Biology 2022Quote: Methylation of peptides (PSL, Heidelberg, Germany, Table S5) was performed using the bioluminescence-based MTase-GloTM Assay (Promega, Cat#V7601) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... peptides were diluted 4-fold with ABC buffer (Ammonium bicarbonate 50 mM pH8) and digested with Trypsin MS grade (Promega) overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... The supernatant was removed and tryptic peptides were eluted from the beads by overnight digestion in 50 µl trypsin solution (V5111, Promega, 0.01 µg/µl in 100 mM ammonium bicarbonate ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were digested to peptides by adding 25 µL of 50 mM ammonium bicarbonate containing 5 µg of trypsin (Promega) and incubating at 37 °C for 18 hours ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified signal peptide fragments were introduced into the plasmid pSUC2 (Prof. Sophien Kamoun, The Sainsbury Laboratory) using T4 DNA ligase (Promega, USA). The yeast invertase assay was used to validate the signal peptides (Jacobs et al ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Stimulation of P-gP ATPase activity was utilized to indicate the interaction between peptides and P-gP using the P-gP-Glo Assay System (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The Flag-TRAF6 preparations eluted from FLAG resin with 3X FLAG peptide were digested with a combination of trypsin and Lys-C protease (Promega, #V5071) using S-trap mini columns (Protifi ...
-
bioRxiv - Cell Biology 2021Quote: ... LgBiT antibody (N710A) and HiBiT antibody were acquired from Promega. Chicken polyclonal MAP2 (ab5392) ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated mouse secondary antibody (Promega). UAP56/DDX39B [1:2000] (custom generated51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibody was detected using HRP-conjugated chicken secondary antibody (Promega).