Labshake search
Citations for Promega :
251 - 300 of 4431 citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Cancer Biology 2021Quote: ... was added to one plate and CellTiter-Glo 2.0 (Promega G9242) was added to another plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luminescence was measured on a Promega GloMax Plate Reader (Promega TM297) with a 6 second integration time.
-
bioRxiv - Microbiology 2022Quote: ... Plates were incubated for 72 hours before nanoGlo substrate (Promega; N1120) was added ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... with measurements conducted on a GloMax-Multi Plate Reader (Promega, E7081). Equal amounts of protein were diluted in 15 μL or 30 μL total volume with 1X Laemmli SDS-sample buffer (Fisher ...
-
bioRxiv - Biophysics 2021Quote: ... the plates were developed with the CellTiter-Glo 2.0 reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... one plate was subjected to CellTiter-Glo (CTG, Promega, Cat# G7570) analysis and the other to Presto Blue (PB ...
-
bioRxiv - Immunology 2021Quote: ... Titration plates were then read using the GloMax® Navigator (ProMega) using the Promega GloMax® Luminescence Quick-Read protocol ...
-
bioRxiv - Immunology 2021Quote: ... Titration plates were then read using the GloMax® Navigator (Promega) and the Promega GloMax® Luminescence Quick-Read protocol ...
-
bioRxiv - Immunology 2022Quote: ... Plates were washed again 3x with PBS and AttoPhos substrate (Promega) was added to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... and the plates were read on a Glomax microplate reader (Promega) at 450 nm ...
-
bioRxiv - Microbiology 2023Quote: ... measured on a plate reader (GloMax® Navigator Microplate Luminometer, Promega). For proteins expression analysis ...
-
bioRxiv - Microbiology 2023Quote: ... Fluorescence was quantified using a Glomax Multi Detection Plate Reader (Promega).
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2023Quote: ... A fragment of the rat Piezo 1 cDNA was amplified with Taq Polymerase and the oligonucleotide primers 5’-GAGGAAGAGGACTACCTT and 5’-TTTACTTAGAAAACCCTACAG from bladder total RNA and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Sequence was confirmed by Sanger capillary sequencing and sense and antisense RNA probes were synthesized with T7 and SP6 RNA polymerases (Roche-Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of Master Mix (Promega, Madison, WI, USA), 3.94 μl of ddH2O ...
-
bioRxiv - Immunology 2019Quote: ... consisting of 5 X Green GoTaq Flexi Buffer (Promega), dNTP mix (0.2 mM per dNTP ...
-
bioRxiv - Immunology 2019Quote: ... 5% CO2 CellTiter 96 Aqueous One Solution (Promega, #G3582) was added to measure cell proliferation ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µL of 5X GoTaq Green Master Mix (Promega), 0.125 µL of 5u/µL GoTaq G2 polymerase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and serial dilutions of indicated human mAbs ...
-
bioRxiv - Systems Biology 2020Quote: 100 mM TEAB and 5 ug trypsin (Promega V5113)
-
bioRxiv - Neuroscience 2021Quote: ... + 5% RNAse inhibitor (40U/ul, Promega RNAsin inhibitor N2511). Samples were then transferred to a tube for processing by our Genome Technology Access Center (GTAC ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Cancer Biology 2021Quote: ... then digested with 5 ng / μl Trypsin Gold (Promega) in 9% Acetonitrile and 40 mM Ambic ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng of Renilla luciferase plasmid (Promega pRL-CMV), and 50 ng of Gal4-DNA binding domain-human RORγt-ligand-binding domain fusion protein plasmid per each well ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µl of 5X Green GoTaq Buffer (Promega, M791A), 0.2 µl of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and 10 μl of pooled mouse sera from naïve or immunized mice with HCoV-OC43 N-His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼ 5 × 105 U2OS cells were transfected using FuGene6 (Promega) with 1μg of gRNA/Cas9 (px330 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Constructs were labeled with 5 μM Halo-TMR (Promega) in the column for 10 minutes at room temperature and unbound dyes were washed with TEV buffer at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 5 μl of reconstituted 1xGTPase-Glo reagent (Promega) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μM Bright-Glo (Fluc Luciferase Assay System, Promega) was then added to the wells ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 U of recombinant RNasin (Promega) and 10 U of RQ1 RNase-free DNase (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg ml-1 Sequencing Grade Modified Trypsin (Promega). Peptides were eluted with 50 mM Tris-HCl pH 7.5 ...