Labshake search
Citations for Promega :
251 - 300 of 3123 citations for 6 Phenyl hexa 3 5 dien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Genomics 2022Quote: ... Quantification of DNA was measured using fluorescence intensity of Quantifluor One dsDNA dye (Promega Quantifluor One dsDNA dye; E4871), inside a 0.5 milliliter thin-walled PCR tube ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Fugene HD (Fugene HD [μL]:DNA [μg]:DMEM [μL] = 5:2:200;Promega, Madison, WI, USA) was used for transient transfection ...
-
bioRxiv - Genomics 2024Quote: ... and 1,750 ng landing pad G384A vector template using 6 μL Fugene 6 (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Three μL (6 ng on average) of template DNA was added to 5 μL 5x GoTaq Green Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 0.625 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Microbiology 2019Quote: ... The genes of interest along with ∼700 bp of 3’ and 5’ flanking DNA were amplified and cloned into the vector pGEM-T Easy (Promega) to create pGEMlpg0277 ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... (49) as a negative control (2 μg of DNA per well of 6 well plate) with FuGene transfection reagent (Promega, Madison, WI) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated for an additional 2 – 6 days and cell growth was quantified using CellTiter-Glo® 2.0 Reagent (Promega, Cat. #924C). For immunoblot analysis ...
-
bioRxiv - Physiology 2023Quote: ... UMR106 cells were plated at 4 × 105 per well in a 6-well plate and transfected with 2 µg of NFAT5 gRNAs per well using the FuGENE® HD Transfection Reagent (Promega, USA). 24 h post-transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... These cells were transfected in 70% confluent 6-wells TC-treated plates with 2 µg TGFβ receptor-Nanoluciferase constructs (constructs were provided by Promega and Promega R&D) using a 1 µg DNA ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Cell Biology 2021Quote: ... or Fugene 6 (Promega #E2691) for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... FuGENE 6 Transfection Reagent (Promega) was used according to the manufacturer’s protocol and the phenotype inspected 24 or 48 h after transfection ...
-
bioRxiv - Genomics 2020Quote: ... using Fugene 6 (Promega, E2691). Virus was then harvested and applied to Scc1-EGFP-AID/dCas9-KRAB cells ...
-
bioRxiv - Neuroscience 2020Quote: ... using FuGENE®-6 (Promega). Supernatants containing viral particles were aseptically collected 3 days post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... using FuGENE 6 (Promega; E2691). Lentiviral particles were harvested and concentrated using a Lenti-X Concentrator (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... using Fugene 6 (Promega # E2691), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using Fugene 6 (Promega #E2691) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Trypsin (6 ng/ml, Promega) in NH4HCO3 (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... using FuGENE 6 (Promega, # E2311). 40 hours post-transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... FuGENE 6 Transfection Reagent (Promega) was used for DNA transfection ...
-
bioRxiv - Microbiology 2020Quote: ... or Fugene 6 (Promega, UK) and virus containing supernatants harvested 3 days later ...
-
bioRxiv - Neuroscience 2021Quote: ... or Fugene® 6 (Promega) in a 3:1 ratio with cDNA mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 μl of FuGene (Promega) transfection reagent was added ...
-
bioRxiv - Microbiology 2020Quote: ... using Fugene 6 (Promega, # E2311). Variants of plasmids encoding spike included the wild-type pCMV-S ...
-
bioRxiv - Cell Biology 2022Quote: ... using Fugene 6 reagent (Promega). The culture supernatant was centrifuged ...
-
bioRxiv - Microbiology 2023Quote: ... using FuGene®6 (Promega) according to the manufacturer’s instructions (Fodor et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... one for use with the NADP+/NADPH Glo Assay and one for use in the NADH/NAD+ Glo Assay (Promega) such that all 4 metabolites will be measured on the same plate for each set of samples ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Microbiology 2022Quote: ... 40 µL of ONE-Glo reagent (Promega #E6110) added and luminescence measured using a Tecan Spark plate reader.