Labshake search
Citations for Promega :
251 - 300 of 4408 citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Microbiology 2023Quote: The genes were cloned one by one into in pGEM-T Easy Vector (Promega, Madison, USA) and finally in pMG36e vector (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... at a protein:Lys-C ratio of 100:1 (w/w) for 4 h at 37°C followed by trypsin (Promega) digestion at a ratio of 50:1 (w/w ...
-
bioRxiv - Cancer Biology 2022Quote: The 4T1-mScarlet and 67NR-GFP cell lines were generated by transfection using a 1:4 ratio of plasmid DNA:FugeneHD reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tryptic digests were performed overnight after addition of 46 μl of 100 mM Hepes pH 7.6 and 4 μl of 1 μg/μl Trypsin Gold (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... at room temperature (r.t.) for 4 hours and then further digested overnight with 1:50 (w/w) trypsin (Promega) at r.t ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL of 1:100 (diluted in phenyl red-free DMEM with 4% FBS) Nano-Glo substrate (Promega N1572) was added in each well ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Microbiology 2020Quote: ... or Vpr F34I/P35N mutant using 6 μl Fugene-6 (Promega). For KPNA-cargo IPs HEK293T cells were grown in 10 cm dishes and co-transfected with 1 μg of a plasmid expressing FLAG-tagged KPNA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTS reagent (CellTiter96 AQueous One; Promega) was added and the optical density was read at 490 nm to assess viability.
-
bioRxiv - Biochemistry 2019Quote: ... Luciferase reagent (Promega One-Glo, E6120) was added to cells after compound treatment and incubated for 10 minutes according to manufacturer recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... ONE-GloTM Luciferase Assay System (Promega) and Renilla-Glo® Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... using QuantiFluor ONE dsDNA kit (Promega) and library size was checked on the Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... using QuantiFluor ONE Lambda DNA (Promega) as a DNA standard ...
-
bioRxiv - Molecular Biology 2022Quote: ... or QuantiFluor ONE dsDNA System (Promega) using QuantiFluor ONE Lambda DNA (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 units of RNase ONE (Promega) was added to the sample ...
-
bioRxiv - Microbiology 2023Quote: One step RT-PCR kit (Promega) was used ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... one volume of CellTiter-Glo (Promega) assay reagent was added to each well ...
-
bioRxiv - Genetics 2023Quote: ... One microgram of Trypsin Gold (Promega) was added to each sample and incubated in an end-over-end mixer at 37°C for 16 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... The QauntiFluor ONE dsDNA System (Promega) is used to quantify the double stranded library ...
-
bioRxiv - Immunology 2024Quote: ... 40 μL of One-GloEX (Promega) was added to the cells and incubated in the dark for 5 min prior to reading on an Agilent BioTek Neo2 plate reader ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 μL of One-GloEX (Promega) was added to the cells and incubated in the dark for 5 min prior to reading on an Agilent BioTek Neo2 plate reader ...
-
bioRxiv - Cell Biology 2019Quote: ... diluted 1/500 in PBS-BSA 1% and 0.4 U.mL-1 RNAsin (Promega). We visualized and quantified 5-FUrd incorporation by using high content imaging device (OPERETTA ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Microbiology 2020Quote: ... HeLa cells were transfected 6 hours before imaging with Fugene 6 (Promega) and 1000ng of DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were digested with 0.5 µg of lysyl endopeptidase (Wako) at room temperature for 4 hours and were further digested overnight with 1 µg trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were incubated at 37°C for 1 hour and then proteolytic digestion was performed with LysC (Wako) for 4 hours and trypsin (Promega) overnight ...