Labshake search
Citations for Promega :
2901 - 2950 of 5310 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... proteins were precipitated overnight with 5 volumes of cold 0.1 M ammonium acetate in 100% methanol and digested with sequencing-grade trypsin (Promega) and each sample was analyzed by nanoLC-MS/MS on a QExactive+ mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (40Ul/µl stock, 5 ml/ml of buffer, Promega). We rinsed sections ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK cells were transfected with 5’UTR-reporters for 24h using ViaFect reagent according to the manufacturer’s protocol (Promega). Next ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 µL of the supernatant were diluted in 45 µL of Luciferase Assay Reagent (Luciferase Assay System, E1500, Promega) and measured at a Synergy HT reader (BioTek ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega) or Phusion HF DNA polymerase (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... The next day cells were treated with compounds and assessed for cell growth 5 days later using CellTiterGlo (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... 5 regions of ieCTNNB1 and the region containing the mutation site were respectively cloned into pGL3- promoter vector (Promega). HEK293T ...
-
bioRxiv - Systems Biology 2024Quote: ... Proteins were digested with 5 µL of 100 mM Ambic pH 8.8 that contained ∼250 ng/µL of Trypsin/rLysC enzyme mix (Promega) (Total amount 1.25 µg ...
-
bioRxiv - Immunology 2021Quote: ... followed by three washes with TBS-T and 1 hr incubation in TBS-T + 1% milk + anti-mouse serum (1:10,000) (Promega). All steps were carried out at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... Thawed tissue was minced and incubated in 1% PFA (with 1 µL mL−1 RNasin Plus (Promega, Madison, WI)) for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with either 0.3 μg/well of Smad4 firefly luciferase reporter plasmid constructs (pLuc366 or pLuc207) or the control pGL3-Basic vector (Promega, San Luis Obispo, USA). The renilla luciferase plasmid was also co-transfected to correct for variations in transfection efficiency (45 ng/well) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were transfected with 1 μg of DNA (1 μg of an L1-expressing plasmid or 0.5 μg of the L1-expressing plasmid and 0.5 μg of either a pCMV-3Tag-8-Barr control or ISG-expressing plasmid) using 3 µL of FuGENE HD transfection reagent (Promega, Madison, WI, United States) and 100 µL of Opti-MEM (Gibco ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... Media was changed at 3 hpi and luciferase luminescence was measured at 24 hpi using the Nano-Glo® Luciferase Assay (Promega, Madison, USA, #N1130) kit ...
-
bioRxiv - Plant Biology 2019Quote: ... Samples were mixed in a 1:1 ratio with substrate (Promega; E1531) and luminescence was measured ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were diluted 1:100 in 1 × passive lysis buffer (Promega) and 5 µl were transferred into a white Nunc 96-well plate ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then diluted 1:1 with MilliQ water and trypsin (Promega) added at the same enzyme to protein ratio ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μL RQ1 DNase (1 U/μL, Promega, cat. no: M6101) and then incubated at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µl forward primer and 1 µl reverse primer (Promega corporation, USA), 3 µl extracted DNA and 14 µl nuclease free water and initial denaturation at 95°C for 10 minutes followed by 35 cycles including annealing temperature which varied in different reaction ...
-
bioRxiv - Genomics 2022Quote: The 293T cells in 96-well plates were transiently transfected with 200 ng Firefly luciferase vector (pGL3) and 4 ng pRL-TK Renilla luciferase vector (Promega, Madison, USA) using 0.5 uL Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... fixed with 4% paraformaldehyde and labeled with rabbit polyclonal anti-GFP (Minotech Biotechnology) and mouse anti-β-galactosidase (Promega Cat# Z3781, RRID:AB_430877) primary antibodies ...
-
bioRxiv - Pathology 2021Quote: ... 30 μg of protein was digested with Lys-C (FUJIFILM Wako Chemicals Europe GmbH, Germany) for 4 h and subsequently with modified porcine trypsin (Promega, WI, USA) for 16 h at 37 °C.
-
bioRxiv - Plant Biology 2020Quote: ... The columns were capped at the bottom and 200 µl AmBic containing 4 ng/µl of Trypsin + LysC (Promega Catalog number V5073) was added to each sample and incubated in a 37°C shaker for 16 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pelleted cells were disrupted by glass beads agitation at 4°C in 1x Passive Lysis Buffer provided in the Dual-Luciferase® Reporter Assay System (Promega, #E1910). Extracts were clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clear supernatant was incubated overnight at 4°C with 100 μl of prewashed Magne® HaloTag® Beads (Promega, WI, USA). Post-incubation ...
-
bioRxiv - Genomics 2023Quote: ... Primers bearing kpnI and BgLII sites (Additional Table 4) allowed incorporation into pGL3-Basic reporter vector containing luciferase gene from the firefly Photinus pyralis (Promega, Wisconsin, USA). Amplification was carried out using Phusion HotStart II Polymerase ...
-
bioRxiv - Immunology 2023Quote: ... 4 µl of cDNA per sample were used and qRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, #A6001) on a LightCycler 96 (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luminescence was measured 24 h after plating (T0) and after 4 d using the CellTiter-Glo Luminescent Cell Viability Assay protocol (Promega; cat# G7573). When indicated ...
-
bioRxiv - Microbiology 2024Quote: ... Cells infected with viruses expressing luciferase were harvested 4 days after infection and analyzed for luciferase activity with a luminescence kit (Bright-Glo™ Luciferase Assay System, Promega, E2620) as described in (61).
-
bioRxiv - Microbiology 2020Quote: ... 1 U RNasin (Promega) and 1 mM DTT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1:1,000 RNasin (Promega)) using a 2ml Dounce homogeniser ...
-
bioRxiv - Neuroscience 2020Quote: ... furimazine (Promega, 1:2000), 20 mM HEPES ...
-
bioRxiv - Neuroscience 2019Quote: ... RNasin (Promega, 1:1000) using a 2 mL glass-Teflon homogenizer with 12 gentle strokes ...
-
bioRxiv - Neuroscience 2019Quote: ... 1× Protease Inhibitor (Promega), Hoechst 33342 10 ng mL−1 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 1× Protease inhibitor (Promega), 0.1 mM DTT (Thermo Fisher)] per 100 mg of tissue with 15 strokes of the loose and 15–20 strokes of the tight pestle ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl DTT (Promega), in 20 µl Superscript II buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg trypsin (Promega) was added to the S-trap for 90 minutes at 47 °C ...