Labshake search
Citations for Promega :
2901 - 2950 of 4194 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 8 μL of 1/10 diluted Nano-Glo® substrate (Promega N1130) and either 10 μM effector and 200 μM partner or just 200 μM partner was added to these wells using a multichannel pipette ...
-
bioRxiv - Genetics 2024Quote: ... and 1 mM DTT in 1x Reaction Buffer A (K03-09, Promega) to a total volume of 25 μl for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA (1 µg) was treated with RQ1 RNase-free DNase (Promega, WI) and then reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed 1 × with PBS and lysed with Cell Lysis Buffer (Promega) at RT for 20min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then lysed in 100 μl of 1× Passive Lysis Buffer (Promega) and luciferase activity in 10 μl aliquots of the cell lysates was measured using the Dual Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 GFP-Sec61β stable cell line was generated by Fugene-HD (Promega) transfection of pAc-GFPC1-Sec61β ...
-
bioRxiv - Neuroscience 2021Quote: ... Further overnight digestion was carried out with 1:20 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/well pGL4.74 plasmid (Luc2P/hRluc/TK, control luciferase reporter plasmid, Promega), and 100 ng/well of SMAD2/3 responsive reporter plasmid pGL4.48 (luc2P/SBE ...
-
bioRxiv - Molecular Biology 2021Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:4000 Promega, Fitchburg, USA) was used as secondary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). The Dual-Luciferase Reporter Assay System and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). Luciferase assay reagent and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers (Supplementary Table 1) and GoTaq® G2 Flexi DNA polymerase (M7801, Promega). Resulting PCR products were purified on columns (Isolate II PCR Kit (BIO-52059 ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were digested overnight at 37 °C with 1 μg of trypsin (Promega). Subsequently ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... approximately 5.2 µg of purified gDNA (spiked with 1% unmethylated lambda DNA, Promega) was sheared into fragment size of 200-300 bp using Covaris S220 ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were digested overnight at 37°C with 1 µg of LysC (Promega) 38 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg RNA was reverse transcribed using GoScript Reverse Transcription Mix (A2790, Promega,) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
bioRxiv - Immunology 2020Quote: ... The medium was supplemented with 1 mM beetle luciferin potassium salt solution (Promega) and bioluminescence assayed at room temperature using Varioskan Flash (Thermo Fischer).
-
bioRxiv - Cancer Biology 2020Quote: ... in a ratio of 100:1 using ViaFect transfection reagent (Promega Cat# E4982). Seven TCF/LEF-binding sites are present upstream of a firefly luciferase gene in the TOPflash vector ...
-
bioRxiv - Bioengineering 2021Quote: ... + 10% FBS containing 1% v/v of cAMP GloSensor substrate stock solution (Promega). The cells were incubated in substrate-containing medium at 37 °C in 5% CO2 for at least 2 h (maximally 8 h) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were resuspended in lysis buffer (1 x FastBreak cell lysis reagent (Promega), 50 μg/mL lysozyme ...
-
bioRxiv - Plant Biology 2020Quote: ... Next 1 µg of total RNA was circularized with T4 RNA ligase (Promega), desalted with Amicon Ultra 0.5ml (10K ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μL of AAV solution was treated with RQ1 DNase (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Inflammasome activity was measured using Caspase-Glo® 1 Inflammasome Assay (G9951; Promega). iPS-Mg were plated at 50,000 cells/well in opaque 96-well plates and treated O/N with PS+ cells ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Cell Biology 2021Quote: ... RPE-1 cells were transfected with pX458 using Fugene HD transfection reagent (Promega) according to the manufacturer’s protocol and 48 hours later cells were selected for 3 weeks with 10 mM Nutlin-3 (Selleck Chemicals) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μL per well of MTS/PMS (20:1, Promega, Madison, WI, USA) solution was added to each well containing 100 μL of culture medium ...
-
bioRxiv - Systems Biology 2022Quote: ... Protein enzymatic cleavage was carried out with trypsin (Promega; 1:20, w/w) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2022Quote: The AP-1 complexes were expressed in BL21 (DE3) pLysS (Promega, Madison, WI) strains and induced with 0.3 mM isopropyl-β-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µl DNA was then PCR-amplified with GoTaq® Green Mastermix (Promega) and locus-specific primers that anneal either within or outside of the excised genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Regenerating axons were then visualized by staining for βIII-tubulin (1:2000, Promega). Cell density was visualized using nuclear marker DAPI (0.2mg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg pHAGE-HA-FIP200-IRES-puro and mutants with FuGENE HD (Promega) for 18 hrs and then treated with 10 μM Oligomycin (Calbiochem) ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatants were collected and incubated with 1 μM HaloTag TMR Ligand (Promega) at room temperature for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... the HIV 5′-UTR (nucleotides 1–497) was cloned into pSP72 vector (Promega) using BglII and EcoRI sites under the control of T7 promoter ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... and 10% glycerol) and a 1:50 dilution of Nano-Glo substrate (Promega). This mixture was placed in a 384 well plate and luminescence was measured in a Spark Plate Reader (Tecan).
-
bioRxiv - Molecular Biology 2022Quote: ... proteins from HL-1 cells were extracted with Passive Lysis Buffer (Promega France). Bioluminescence was quantified with a luminometer (Centro LB960 ...
-
bioRxiv - Plant Biology 2022Quote: ... DNase was inactivated by adding 1 μl of RQ1 DNase stop buffer (Promega). The DNase-treated RNAs were subsequently reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein enzymatic cleavage was carried out with trypsin (Promega; 1:50, w/w) at 37 °C for 16 h ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were digested overnight by adding 1 μg of trypsin (Promega, Madison, Wisconsin) in 100 μL ABC at 37 °C overnight ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 150 nM of LactC2-eGFP and 0.07 U μL−1 RQ1 DNase (Promega). Liposomes were then transferred to the tube with deposited dried precursor films ...
-
bioRxiv - Genetics 2020Quote: ... 1 uM of each primer and 1X of reaction buffer (Promega, Madison WI). Thermal cycles were set up to an initial denaturing step of 95 C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 25 pmol of each primer and 1 U of GoTaq DNA polymerase (Promega). Reactions were run by an initial denaturalization (5 min ...
-
bioRxiv - Systems Biology 2021Quote: ... Proteins were digested overnight by adding 1 μg of trypsin (Promega, Madison, Wisconsin) in 100 μL ABC at 37 °C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... The membranes were probed with horseradish peroxidase-conjugated secondary IgG (1:7000, Promega) for 1 hr at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... The primary antibodies that were used are mouse β-Gal (1:250; Promega), mouse anti-Cora C615.16 (1:400 ...
-
bioRxiv - Cancer Biology 2021Quote: ... then digested overnight at 37 °C with 1 μg Lys-C (Promega, VA1170) and dried in vacuo ...
-
bioRxiv - Plant Biology 2020Quote: ... 100µg protein were digested in solution with RapiGestTM with 1 µg Trypsin (Promega) over night ...
-
bioRxiv - Developmental Biology 2021Quote: The antibodies used were: Rabbit anti-pJNK pTPpY (1:500, Promega, Cat#V93B), Rat anti-Ci(1:1,000 ...