Labshake search
Citations for Promega :
2851 - 2900 of 6504 citations for Cortisone Chemiluminescent ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... 1 unit of Taq polymerase (Promega, Madison, WI, USA), and approximately 75 ng of schistosome genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/µL Rnasin® Plus RNAse inhibitor (Promega), 2 mM DTT ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-β-Galactosidase (#Z3781, 1:200) from Promega; rabbit anti-SWS (1:1000 from Doris Kretzschmar) ...
-
bioRxiv - Microbiology 2023Quote: ... which were digested with 1 µg Lys-C (Promega) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti- mouse IgG antibody (1:1,000, #S3721, Promega).
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... then with trypsin (Promega; 1:50, 37°C overnight). Samples were purified by solid-phase extraction (SepPak tC18 cartidges ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 μL of CellTiter Glo (Promega, diluted 1:6), was added to each well and luminescence was measured with an Envision plate reader ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mouse anti-β-galactosidase (Promega #Z378, 1:1000) or rabbit anti-mCherry (BioVision ...
-
bioRxiv - Biochemistry 2023Quote: ... For trypsin digestion 1 μg of trypsin (V5111; Promega) was added ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg ml-1 Sequencing Grade Modified Trypsin (Promega). Peptides were eluted with 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and RNasin® Ribonuclease Inhibitor (#N2615, Promega; 1:1000)) ...
-
bioRxiv - Microbiology 2024Quote: ... leaves were sprayed with 1□mM luciferin (Promega, E1603) and 0.02 % (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was first extracted using the SV Total RNA Isolation kit (Promega, Beijing, China) before cDNA was synthesized using the PrimeScript RT reagent kit with gDNA Eraser (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was extracted and purified using the Wizard® Genomic DNA purification kit (Promega) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2020Quote: Measurement of NADPH ratio was performed using an NADP/NADPH-Glo™ assay kit (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from cells using the ReliaPrep™ tissue system kit (Promega; Z6012). cDNA was produced from 1 μg of RNA sample using M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from TA muscle with SV Total RNA isolation kit (Promega, Z3100) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was isolated using the Wizard Genomic DNA purification kit (Promega, Leiden, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples were extracted by Eastep® Super Total RNA Extraction Kit (Promega, Madison, WI) by following the suggested protocol within 24-36 hours after infiltration ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were harvested for quantification of cAMP activity using the cAMP-GLO Assay Kit (Promega). Percent increase in cAMP activity was calculated by the difference between control and treated groups ...
-
bioRxiv - Developmental Biology 2021Quote: ... Then RNA samples were reverse transcribed to cDNA by M-MLV reverse transcription kit (Promega). The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... and EGFP were synthesized using the RiboMAX Large Scale RNA Production System T7 kit (Promega). Approximately 100 μg of synthesized dsAntp was injected into the second chest spiracle at the first day of Bombyx larval wandering stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and quantitated using a Quantus fluoromoter with the QuantiFluor dsDNA kit (Promega, Madison, WI, USA). The isolates were identified using form-specific molecular markers and PCR conditions described in Poudel et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each quantitative RT-qPCR reaction was performed using the GoTaq qPCR Master Mix kit (Promega). For a 10 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Firefly and Renilla luciferase activities were determined by Dual-luciferase Reporter Assay kit (Promega, E1910). The STAT3 luciferase reporter plasmid was purchased from Affymetrix ...
-
bioRxiv - Immunology 2022Quote: ... vRNA was isolated from plasma using the Maxwell Viral Total Nucleic Acid Purification kit (Promega) on a Maxwell 48 RSC instrument (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... firefly and Renilla luciferase activities were determined by Dual-luciferase Reporter Assay kit (Promega, E1910). To evaluate NF-κB activity ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic DNA was extracted from the cells using a Wizard Genomic DNA Purification Kit (Promega). DNA libraries were prepared using a Nextera XT kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was isolated using the automated Maxwell LEV 16 simplyRNA tissue kit (AS1280, Promega). cDNA was synthetized from 500 ng total RNA using Superscript III (18080085 ...
-
bioRxiv - Genetics 2021Quote: ... and cDNA was synthesized by ImProm-II™ Reverse Transcriptase kit (Promega, Madison, WI, USA). qRT-PCR was performed by using StepOne Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... firefly and Renilla luminescence were measured using the Dual-Glo Luciferase activity kit (Promega, E2920) and the DTX 880 Multimode Detector (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2019Quote: ... which were performed with the use of GoScript RT kit following the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... Human cell lines were DNA fingerprinted for provenance using the Power-Plex 1.2 kit (Promega) and confirmed to be the same as the DNA fingerprint library maintained by ATCC ...
-
bioRxiv - Systems Biology 2019Quote: ... Luciferase activity was measured 48 hours after transfection using the Luciferase Assay System kit (Promega) on a Enspire luminometer (Perkin-Elmer) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were subsequently lysed directly in firefly luciferase substrate from Promega (Dual-Glo Luciferase kit) for 30 min ...
-
bioRxiv - Genomics 2019Quote: ... using silica columns included in the SV Total RNA Isolation System extraction kit from Promega. The integrity of the obtained RNA was determined by electrophoresis in 2% agarose gel ...