Labshake search
Citations for Promega :
2851 - 2900 of 3883 citations for 6 METHOXY 2 METHYL 1 PHENYLSULFONYL 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... 1 µL of enzyme mix (lysC & trypsin, 10 ng/µL in water, Promega, Cat. V5072) was dispensed into each well by using the pL-volume dispensing function of the cellenONE at 20°C and 85% humidity ...
-
bioRxiv - Microbiology 2023Quote: ... 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega, 0.4 u/µl) in a final volume of 30 µl at 25°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Bound antibodies were detected using the appropriate horseradish peroxidase-conjugated secondary antibodies (1:10000, Promega). Chemiluminiscent signals were detected with an ECL Prime Western blotting detection kit (GE Healthcare ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ten ml of conditioned media was treated with 1 ml Proteinase K (Promega Cat # V3021) in buffer (10 mM Tris-Cl pH8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... and samples were digested with 1:15 mass ratio of Sequencing Grade Modified Trypsin (Promega) using an S-trap mini device (Protifi ...
-
bioRxiv - Biochemistry 2024Quote: ... Trypsin digestion was performed with a 1 μg /μL trypsin solution (Trypsin Gold, V528A, Promega) at a ratio of 1:50 at 37 °C for 16 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then placed in a 50 mL solution of 1 ×Diamond Nucleic Acid Dye (Promega) in 0.2 ×TBE buffer pH 7.6 to rock in the dark for 30 min ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... the sample was digested overnight at 37 °C with trypsin (1:200 w:w; Promega, Madison, WI). Peptides were desalted using a Sep-Pak (Waters ...
-
bioRxiv - Cell Biology 2019Quote: The primary antibody was incubated in 1× PBST (PBS + 0.1% Triton X-100) + 0.2% BSA (Promega) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNAs were diluted 1:5 and qPCR was performed using GoTaq® qPCR Master Mix (Promega). Primers for mCyb5r3 were ...
-
bioRxiv - Pathology 2020Quote: ... The extracted RNA (1 μg) was reverse-transcribed using Reverse Transcription System (Promega, Madison, Wisconsin, USA), and cDNAs were amplified using GeneAmp PCR System 9700 (Applied Biosystems ...
-
bioRxiv - Biochemistry 2019Quote: ... 20 μg of each sample was digested by adding 1 μg of sequencing grade trypsin (Promega) for 16 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the membrane was imaged using 500 µl of 1:1000 NanoGlo substrate (Promega, catalogue number: N1120) diluted in 10 mM sodium phosphate buffer pH 7.0.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred nanograms of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA (Promega) was used for the library preparation ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were digested overnight at 37°C with 1 μg trypsin (sequencing grade; #V5111, Promega) per 100 μg of protein.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... at a 1:1000 dilution and a secondary antibody against rabbit coupled to HRP (Promega W4011) at a 1:20 000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... cells were washed once with PBS and lysed in 40μl of 1 x CCLR buffer (Promega) for 10 min on a rocking plate at RT ...
-
bioRxiv - Microbiology 2021Quote: ... The infected cells were collected and lysed with 100 μl of 1× passive lysis buffer (Promega). The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µg of RNA was used to create cDNA with the ImpromII Reverse Transcriptase Kit (Promega) following the manufactures standard protocol including oligodT oligos and 4.8 M MgCl2 in each 20 µl reaction (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... Promega standard protocol was used to synthesise cDNA from 1 μg RNA (Promega, Madison, Wisconsin, USA). Cripto ...
-
bioRxiv - Cell Biology 2021Quote: ... USA] and enzymatically proteolysed using trypsin/LysC (1:25 enzyme:protein ratio; V5072, Promega, Madison, WI, USA). Peptides from each sample were labelled using the ten-plex TMT reagent kit (90110 ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were digested into peptides with 12μL of 1:10 Trypsin Gold (Promega, Madison, Wisconsin, V528A) in 50mM TEAB per sample ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was prepared with 1 µg of RNA using an AMV reverse transcription system (Promega) and random primers according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega,V5113) for 12 h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK-293 cells were transfected with pmirGLO Dual-Luciferase miRNA Target Expression Vector (1 μg, Promega) containing a control reporter gene Renilla luciferase (hRluc ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of genomic DNA from the corresponding isolates was digested by EcoRI (Promega, Madison, WI), the amplified DNA fragments were subjected to ethanol precipitation (65) ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then subjected to immunoblotting and probed for anti-p75NTR (Promega, Cat: G323A, 1:300) and anti-GAPDH (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... for 4 h at 800 rpm and 42°C or thermolysine (1:50) (Promega, Walldorf, Germany) for 2 h at 800 rpm and 60°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Reverse transcription was performed with 1 unit of Avian Myoblastosis Virus (AMV) reverse transcriptase (Promega®) at 42°C for 2 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA was synthesized using 1 µg total RNA with MMLV Reverse Transcription Kit (Promega) and poly-T primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µL of PBS containing 4 μg/mL Hoechst and 1/10000 CellTox Green Dye (Promega) were were dispensed per well 1 h prior to imaging at Cytation5 image cytometer or Opera Phenix (Perkin Elmer ...
-
bioRxiv - Cell Biology 2020Quote: ... DLD-1 cells were transfected with guide plasmids and donor plasmid using ViaFect™ (#E4981, Promega) on 3.5cm dishes ...
-
bioRxiv - Cancer Biology 2019Quote: ... and trypsin digestion was performed with a 1:50 mass ratio of sequencing-grade trypsin (Promega) to total protein for 16h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1mM DTT and RNasin Plus (1:50) and 25 units of ProTEV Plus Protease (Promega V6101) and incubated 2 hrs at 30°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... were secondary incubated with anti-mouse IgG (H+L) horseradish peroxidase coupled (1:3,000, W402b, Promega) and polyclonal anti-rabbit IgG (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used were: rabbit and mouse anti-βGal (1/1000; Promega and MP Biomedicals, respectiveley), rat anti-Ser (1/1000 ...