Labshake search
Citations for Promega :
2851 - 2900 of 4574 citations for 6 CHLORO 2 METHYLIMIDAZO 1 2 A PYRIDINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-β-Gal (1:1000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5000 ...
-
bioRxiv - Genetics 2020Quote: ... Thereafter 1 μg of sequencing grade modified Trypsin (Promega) was added to each sample (1:33 trypsin:protein ...
-
bioRxiv - Cell Biology 2020Quote: ... with 1 mM EDTA (Promega Life Sciences, USA, #V4231) and 100 mM Tris-HCl pH 7.5 (Quality Biological ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rabbit (1/20000, Promega, W4021 and W4011, respectively) and anti-rat (1/10000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 1 U/μl RNase inhibitor (RNaseIn, Promega), 20 μM amino acid mix (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAsin Plus RNase inhibitors were added (1:1,000, Promega). Following secondary antibody incubation ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... Secondary antibody (donkey α-goat HRP, Promega, 1:10,000). For His-tagged proteins ...
-
bioRxiv - Molecular Biology 2019Quote: Goat anti-rabbit IgG HRP 1:1000 (Promega W4011)
-
bioRxiv - Biochemistry 2022Quote: ... and 1 μG of sequencing grade trypsin (Promega, V5111) was added for 18 h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-β-galactosidase (1:1,000, Promega, Cat#: Z3781), rabbit anti-β-galactosidase (1:5,000 ...
-
bioRxiv - Microbiology 2022Quote: ... with 1:500 Enduren luciferase substrate (Promega, Madison, WI) added ...
-
bioRxiv - Biochemistry 2022Quote: ... proteins were digested with 1) chymotrypsin (Promega, Madison, USA), 2 ...
-
bioRxiv - Microbiology 2022Quote: ... and 120 μL 30 mg mL-1 lysozyme (Promega), followed by 30 min incubation at 35 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 µL RNasin® Ribonuclease Inhibitor (Promega Part # N211A), with 5 µl 5X First Strand Buffer (Invitrogen Catalog Number 18067017 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 µL of CellTiter-Fluor™ (Promega, Madison, Wisconsin) was added using a BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1 µL of CellTiter-Fluor™ (Promega, Madison, Wisconsin) was added using a BioRAPTR FRD™ ...
-
bioRxiv - Biochemistry 2024Quote: ... to reach 1% vol/vol as recommended by Promega, then mixed with YZ-01-A (final DMSO 1% vol/ vol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of sequencing grade trypsin (Promega, Wisconsin, USA) was added and samples were incubated at 37 °C overnight.
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... Fractions were complemented using LgBiT (Promega, 1:200 dilution) and nanoluc substrate (Promega ...
-
bioRxiv - Genetics 2024Quote: ... A 1:10 ratio (enzyme: protein) of Trypsin (Promega) and LysC (Wako ...
-
bioRxiv - Cell Biology 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... containing trypsin (Promega; final 1/100 enzyme/protein ratio) and LysC (Wako ...
-
bioRxiv - Biochemistry 2023Quote: ... For trypsin digestion 1 μg of trypsin (V5111; Promega) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37ºC ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 unit of Taq polymerase (Promega, Madison, WI, USA), and approximately 75 ng of schistosome genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/µL Rnasin® Plus RNAse inhibitor (Promega), 2 mM DTT ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM CaCl2 and sequencing grade trypsin (Promega, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Microbiology 2023Quote: ... and the addition of 1:1000 Nano-Glo (Promega). The bioluminescent signal was measured using a CLARIOstar luminometer (BMG Labtech ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of RNA treated with DNase (RQ1, Promega) was reverse-transcribed by Superscript III (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-β-Galactosidase (#Z3781, 1:200) from Promega; rabbit anti-SWS (1:1000 from Doris Kretzschmar) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mouse anti-β-galactosidase (Promega #Z378, 1:1000) or rabbit anti-mCherry (BioVision ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti- mouse IgG antibody (1:1,000, #S3721, Promega).
-
bioRxiv - Microbiology 2023Quote: ... which were digested with 1 µg Lys-C (Promega) overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... then with trypsin (Promega; 1:50, 37°C overnight). Samples were purified by solid-phase extraction (SepPak tC18 cartidges ...
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Systems Biology 2024Quote: ... Then 1 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg ml-1 Sequencing Grade Modified Trypsin (Promega). Peptides were eluted with 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...