Labshake search
Citations for Promega :
2801 - 2850 of 4685 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg of sgRNA construct and 1.5 μg of linearized HDR plasmid were transfected into RPE1 cells using Fugene 6 (Promega). Positive cells were FACS sorted to isolate the Ndc80-EGFP expressing cells and single clones were identified by visual inspection with fluorescent microscope ...
-
bioRxiv - Biochemistry 2019Quote: ... 70 000-100 000 cells (in 200-450 μl DMEM) were seeded into each well containing a transfection cocktail of 0.4 μl of Fugene 6 (E2693, Promega), with 20 μl Opti-MEM (11058-021 ...
-
bioRxiv - Developmental Biology 2019Quote: ... were injected with dsRNA throughout and frozen in Trizol on dry ice after 6 days in vitro for RNA extraction according to manufacturer’s protocol and DNAse (Promega) treatment for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... were transfected with 1 µg of DNA and 4 µL FuGENE 6 in 100 µL Opti-MEM media for 24-36 hours according to the manufacturer’s instructions (Promega). Cells were fixed with 4% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 μg/mL) ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with WT or mutant C10 constructs using the FuGENE 6 transfection reagent (Promega, cat# PRE2691). The cells were incubated at 37 C at least overnight before downstream analysis.
-
bioRxiv - Neuroscience 2020Quote: ... and 0.4 pmol/well of hairpin constructs (pscAAV-GFP-shFoxP1 or shCtrl) using FuGENE 6 Transfection Reagent (#E2691, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Vero E6 cells (1.2 x 106 cells/well, 6-well format) after 24 hpi using passive lysis buffer (Promega) based on the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Viral particles were packaged in HEK293T cells seeded at a density of 1.5×106/10cm petri dishes in a proportion of 24μL Fugene 6 (Promega, E2691) in 136μL serum-reduced OPTI-MEM (Gibco ...
-
bioRxiv - Microbiology 2020Quote: Env-pseudotyped luciferase reporter viruses were generated by co-transfection of 810 ng of an env expression vector and 810 ng of pZM247Fv2Δenv backbone (22) using 293T cells and the Fugene 6 reagent and protocol (Promega). Five hours after transfection ...
-
bioRxiv - Genetics 2019Quote: ... genes were isolated from C57BL/6 mouse genomic DNA by standard PCR and inserted into the pGL4.10 vector (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... The constructs (1.2 µg) were cotransfected with vesicular stomatitis virus G (600 ng) and pSPAX2 (800 ng) using FuGENE 6 (Promega). The lentiviral supernatants were collected 2 days after transfection ...
-
bioRxiv - Developmental Biology 2020Quote: ... C2C12 myoblasts were seeded at 20-30% confluence in 10cm format (CELLSTAR) and forward-transfection with Fugene-6 (Promega) according to manufacturer’s protocol with the following plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... the D10ACas9 nickase and the HDR template on 6-well plates at 70% confluency using FuGene® HD (Promega). Cells were allowed to recover for 7-10 days (splitting if necessary ...
-
bioRxiv - Biochemistry 2022Quote: ... and penicillin (100 U/ml)/ streptomycin (100 μg/ml) (complete media) then transfected with Fugene 6 (Promega, Madison, WI). Cells were then lysed 2 days post-transfection using a lysis buffer containing 150 mM NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega, Cat #E2691). Media containing lentiviral particles were collected at 24 ...
-
bioRxiv - Cell Biology 2022Quote: ... pX459-derived plasmids encoding both Cas9 and the gRNA were transfected using Fugene 6 (cat. no. E2692 from Promega). 24 h post-transfection puromycin was used to select for transfected cells ...
-
Loss of intermicrovillar adhesion impairs basolateral junctional complexes in transporting epitheliabioRxiv - Cell Biology 2024Quote: A validated CDHR2 KO CL4 cell clonal population was transfected with pHALO-N3-CDHR2 using FuGENE 6 (Promega #E2691) at a FuGENE:DNA (μL:μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 μg/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Microbiology 2023Quote: ... 6 μg of IMC was transfected into 293T cells in a T25 flask using the FuGENE6 transfection reagent (Promega). The cells were cultured at 37°C for 6 hours before the medium was replaced by fresh medium ...
-
bioRxiv - Microbiology 2023Quote: HFF or HEK293 cells (3 × 104 cells per well of a 24-well plate or 1 × 105 cells per well of a 6-well plate) were reverse transfected with 0.5 μg of pCW57-CMV-KDEL-mCherry-GF using Fugene HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Beads were washed 6 times with 50 mM ammonium bicarbonate and then treated with TPCK-treated modified trypsin (Promega) for 16 hours at 37°C on an end-over-end rotator ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfection was performed at ∼5 DIV after half-replacing the medium with fresh proliferation medium using Fugene 6 (Promega) with the following ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... they were transfected with either control plasmid or Flag-GSK-3α WT human plasmid using Fugene 6 (Promega, #E2693) at a 3:1 ratio (DNA:Fugene 6) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM dNTP mix and RNasin Ribonuclease Inhibitors (Promega). This mixture was incubated at 25 °C for 10 min ...
-
bioRxiv - Cell Biology 2019Quote: ... alkylated and digested with 2 μg of Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were digested with 2 μg Trypsin (Promega V5280) for 20 hrs at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... and 2 U/μL RNasin Plus RNase Inhibitor (Promega). We performed DNase digestion at 37 °C for 1 hour followed by a 95 °C inactivation for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% (w/v) bisacrylamide (0.05% final concentration; V3141, Promega), 10× phosphate buffer saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2) an RNAse inhibitor (1µL/mL of RNasin - Promega) was added to all the solutions after the fixation/permeabilization step ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 μL T7 Express Enzyme Mix (Promega, P1320) and incubated at 37 °C for 4 hours unless otherwise indicated ...
-
bioRxiv - Biophysics 2022Quote: ... and then digested with 2 μg of trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 μg Sequencing Grade Modified Trypsin (Promega, Madison, WI) was added to each sample and digested overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... comprised of 2% (v/v) of GloSensor reagent (Promega, #E1290 ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of Wizard DNA Clean-Up resin (Promega) was added to the solution and mixed by inversion for two minutes ...
-
bioRxiv - Biophysics 2020Quote: ... 2 x GoTaq®qPCR Master Mix (Promega, Switzerland) and 1 μl cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... the sample was digested with trypsin (2 μg, Promega) in 50 mM ammonium bicarbonate (100 μl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 μL of 20-fold diluted furimazine stock (Promega) in live cell substrate (LCS ...
-
bioRxiv - Microbiology 2024Quote: ... (2) addition of 600μL of Nuclei Lysis Buffer (Promega), and (3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (2) DNA template degradation by the DNaseI free (Promega), and (3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 2 µl of Fugene HD transfection reagent (Promega). The control reporter plasmid was transfected in parallel in equimolar amounts with pEGFP or pPRKRA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL of CellTiter-Glo reagent (Promega, cat # G9683) was dispensed to each microplate well via BioRAPTR FRD ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μL of ONE-glo luciferase detection reagent (Promega) was dispensed per well and luminance signal recorded with an Envision plate reader (Perkin Elmer).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 mM TEAB and 2 µg LysC+trypsin (Promega) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of Nano-Glo Luciferase Assay Reagent (Promega) and 18 μl ddH2O were added to induce luminescence development ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).