Labshake search
Citations for Promega :
2751 - 2800 of 3826 citations for 5 NAPHTHALEN 1 YL 2H PYRAZOL 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR (qPCR) reactions included 10 μl 1 X GoTaq® qPCR Master Mix (Promega), 0.5 μM of each primer and 5 μl template cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... and digestion for 18 hours with 1 µg of TPCK- trypsin (Promega, Madison, WI, USA) in presence of 10% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2023Quote: ... vigorously vortexed for 1 min and mixed with 40 μL of Proteinase K Solution (Promega France ...
-
bioRxiv - Microbiology 2023Quote: ... vigorously vortexed for 1 min and mixed with 40 μL of Proteinase K Solution (Promega France ...
-
bioRxiv - Pathology 2023Quote: ... RNA (1 µg) was reverse transcribed using GoScript Reverse Transcription System (A5001, Promega, Madison, WI). cDNA was measured by quantitative PCR with FastStart Universal SYBR Green Master (Rox ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were washed and incubated with the appropriate HRP-conjugated secondary antibody (Promega, 1:3000) and the reaction was finally visualized with the Western Blotting Luminol Reagent (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with trypsin (enzyme to protein ratio of 1:100) (Promega, Germany) at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies used included alkaline phosphatase-conjugated anti-rabbit IgG antibody (1:1,000, #S3738, Promega) and anti- mouse IgG antibody (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing of the gRNA-targeted exon 1 was performed by PCR amplification (Promega GoTaq polymerase) with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al. ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg of total RNAs was reverse-transcribed using ImProm-IITM Reverse Transcription System (Promega) and genes were analysed with Quantifast SYBR green master mix (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM DTT) buffer and luminescence activity was measured with the Luciferase Assay System (Promega).
-
bioRxiv - Microbiology 2023Quote: Viral loads were quantified using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-COV-2 the nCOV_N1 primer/probe mix from the SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Biophysics 2023Quote: ... Cross-linked samples for XL-MS were digested by 1:50 (m/m) trypsin (Promega) overnight at 37 °C while shaking at 600 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA (1 μg per reaction) was reverse transcribed using the GoScript Reverse Transcription System (Promega). Following reverse transcription ...
-
bioRxiv - Immunology 2023Quote: ... Complementary DNA (cDNA) was generated using 1 μg RNA using M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 37° C with 1 μg mass spectrometry grade Trypsin (Promega). The resulting peptide sample was acidified with 10% formic acid and 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Plant Biology 2023Quote: High concentration (1 µg/µL) plasmid DNA was extracted via maxi-prep (Promega SV Wizard). Lower quality plasmid DNA (e.g ...
-
bioRxiv - Microbiology 2023Quote: ... 0.25 µl 1 M MgCl2 and 0.3 µl Rnasin ribonuclease inhibitor (Promega, 0.4 u/µl) in a final volume of 30 µl at 25°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Bound antibodies were detected using the appropriate horseradish peroxidase-conjugated secondary antibodies (1:10000, Promega). Chemiluminiscent signals were detected with an ECL Prime Western blotting detection kit (GE Healthcare ...
-
bioRxiv - Immunology 2023Quote: ... horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (1:10000) (Promega, Madison, WI, USA), diluted in 3% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were again diluted to 2 M urea and digested with 1 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Biochemistry 2024Quote: ... Then membranes were incubated with secondary anti-rabbit IgG horse radish peroxidase (Promega, 1:5000) for 1 hour ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... The blot was probed with 1:1000 dilution of anti-NLuc antibody (Promega cat#7000) and the bands detected by chemiluminescent detection.
-
bioRxiv - Cell Biology 2024Quote: ... and samples were digested with 1:15 mass ratio of Sequencing Grade Modified Trypsin (Promega) using an S-trap mini device (Protifi ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ten ml of conditioned media was treated with 1 ml Proteinase K (Promega Cat # V3021) in buffer (10 mM Tris-Cl pH8.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... pH 8.0) containing 2 nM 11S and 1/250 Nano-Glo Luciferase Assay Reagent (Promega) was added to the cells and background luminescence read for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Trypsin digestion was performed with a 1 μg /μL trypsin solution (Trypsin Gold, V528A, Promega) at a ratio of 1:50 at 37 °C for 16 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then placed in a 50 mL solution of 1 ×Diamond Nucleic Acid Dye (Promega) in 0.2 ×TBE buffer pH 7.6 to rock in the dark for 30 min ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...
-
bioRxiv - Biochemistry 2019Quote: ... the sample was digested overnight at 37 °C with trypsin (1:200 w:w; Promega, Madison, WI). Peptides were desalted using a Sep-Pak (Waters ...
-
bioRxiv - Cell Biology 2019Quote: The primary antibody was incubated in 1× PBST (PBS + 0.1% Triton X-100) + 0.2% BSA (Promega) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Total DNA was isolated from 1 ml culture using the Wizard Genomic DNA Purification Kit (Promega). Concentration and quality of the extracted DNA was assessed using the NanoDrop™ (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2020Quote: ... The extracted RNA (1 μg) was reverse-transcribed using Reverse Transcription System (Promega, Madison, Wisconsin, USA), and cDNAs were amplified using GeneAmp PCR System 9700 (Applied Biosystems ...
-
bioRxiv - Biochemistry 2019Quote: ... 20 μg of each sample was digested by adding 1 μg of sequencing grade trypsin (Promega) for 16 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the membrane was imaged using 500 µl of 1:1000 NanoGlo substrate (Promega, catalogue number: N1120) diluted in 10 mM sodium phosphate buffer pH 7.0.
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred nanograms of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA (Promega) was used for the library preparation ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were digested overnight at 37°C with 1 μg trypsin (sequencing grade; #V5111, Promega) per 100 μg of protein.
-
bioRxiv - Microbiology 2020Quote: ... The cells were then lysed with 40 μL of 1× Cell Culture Lysis Reagent (Promega, E153A) for 40 minutes with shaking at 500 rpm ...