Labshake search
Citations for Promega :
2501 - 2550 of 2920 citations for 7 Phenyl 1 heptanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... S2-VP10 cells were co-transfected with 0.5 μg of each luciferase reporter plasmid and 1 ng of pRL-SV40 (Promega, E2231) the day after plating (3.45 × 104 cells/well in a 24-well plate ...
-
bioRxiv - Genomics 2022Quote: ... A single colony was used to inoculate LB Broth and genomic DNA extracted from 1 mL using a Promega Wizard kit according to the manufacturer’s instructions (Promega, USA). DNA was quantified using the Qubit 3 and Nanodrop (Thermofisher ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega).
-
bioRxiv - Microbiology 2022Quote: ... The cells were incubated for 24 hrs at 37 °C (for HEK-293T) or 39 °C (DF-1) and luciferase activity was measured by using the Dual-Glo luciferase assay system (Promega). The polymerase activity was calculated by normalising firefly luciferase activity relative to the Renilla luciferase activity.
-
bioRxiv - Plant Biology 2022Quote: ... were reduced with DTT and then alkylated with iodoacetamide and digested overnight using Lys-C/Trypsin (1:50, enzyme to protein; Promega). After terminating the digestion with 1% trifluoroacetic acid ...
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... the samples were digested by trypsin with 1/80 (w/w) trypsin/total protein ratio (Sequencing Grade Modified Trypsin, Promega) according to the manufacturer recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was transcribed from 1 ug of MIuI-linearized DNA using T7 RiboMAX Express Large Scale RNA Production System (Promega). Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4·3Δenv-Luc and Spike-Δ19-D614G by using profection mammalian transfection kit (Promega Inc.). After 48 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then diluted with 50 mM NH4HCO3 to a final concentration of less than 2M urea and then and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then diluted with 50 mM NH4HCO3 to a final concentration of less than 2M urea and then and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were purified on a 1% agarose gel and ligated into a pGEM-T Easy Vector Systems (Promega) plasmid followed by transformation in E ...
-
bioRxiv - Plant Biology 2022Quote: ... The coding sequence of nLUC (aa 1-416) and cLUC (aa 398-550) were amplified from pSP-LUC+NF (Promega) and inserted between ApaI and XbaI in pSAT1A-cYFP-N1 (ABRC ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... and the resulting products were checked on agarose gel (1%) and purified using the Wizard SV Gel and PCR Clean-Up System (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Alkylated proteins were then cleaved using a two-step digestion: first with Endoproteinase Lys-C (ratio 1:33 enzyme: lysate, Promega) for 1 hour at 37 °C then with Trypsin (ratio 1:33 enzyme ...
-
bioRxiv - Microbiology 2023Quote: ... cells were infected with HIV-1 for 48 hours before luminometric quantification of luciferase activity using the Luciferase Assay System (Promega).
-
bioRxiv - Biochemistry 2024Quote: ... at a 1:75 enzyme to protein ratio for 6 h at 30 °C and then by trypsin (V5111, Promega) (1:50 enzyme to protein ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Denatured proteins were enzymatically digested for 14 h at 37 °C with 1 µg of sequencing-grade Trypsin (V511A, Promega). After speed-vaccum drying ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of extracted DNA was added to an amplification mixture containing 1 µl (10 µM) of primers and 12.5 μl of PCR Master Mix Plus (Promega, USA). To each mixture ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... QRT-PCR reactions were performed by using the GoTaq®1-Step RT-qPCR System (Promega Scientific, Madison, WI, USA) with Bio-Rad CFX Connect (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was removed and pellet was resuspended in 400 µL of sort buffer (1 mM EDTA 0.2 U/µL RNase inhibitor (Promega, N211B), 2% BSA (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21ºC overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Afterwards the samples were diluted to decrease the concentration of urea up to 1 M and supplemented with additional amounts of sequencing-grade trypsin (Promega) (200 ng for pull-down samples and 1 ug for total lysate samples) ...
-
bioRxiv - Microbiology 2024Quote: ... SL100688) with the exception of BCBL-1 cells that were transfected with FuGENE HD transfection reagent (Promega, Cat. No. E2311,). Competition reporter assays were performed with co- transfection of the TR7 reporter plasmid with or without LANA expression plasmid (DY52) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We isolated and purified genomic DNA from 1 mL of the overnight cultures using the Wizard DNA purification kit (Promega). Short-read sequencing (2 x 150bp paired-end reads ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions were subjected to primer extension at 42°C for 45 min using 1 unit of MMLV-RT (Promega) and 0.5 mM of dNTPs ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were digested with 1 μg of lysyl endopeptidase (Wako) at room temperature overnight and were further digested overnight at room temperature with 1 μg trypsin (Promega). The resulting peptides were desalted with an HLB column (Waters ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting supernatant was diluted at 1:50 with PBS and used for luminescence measurement with the Nano-Glo Luciferase Assay System (cat. #N1110, Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 49 ng of a TP1-Luciferase (Kurooka et al., 1998; Minoguchi et al., 1997) and 1 ng Renilla-Luciferase (pRL-TK, Promega) using Lipofectamine™ 2000 (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: β-arrestin2 recruitment to human chemokine receptors in response to 1 µM VUF15485 or 200 nM positive control chemokines was also monitored by NanoLuc complementation assay (NanoBiT, Promega) (Dixon et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were diluted with 50 mM NH4HCO3 to a final concentration of less than 2 M urea and were further digested overnight with 1:25 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Protein mixtures were diluted in 1:6 ratio (v/v) using ultrapure water prior to digestion using sequencing grade trypsin (Promega) at 37°C for 16 h ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed once with PBS and lysed for at least 1 h with 40 μl 1x passive lysis buffer (Promega) at RT ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 40,000 cells per well were seeded into poly-D-lysine-coated 96-well plates (Brand, 781965) and the Halo-ligand was added (1:2,000; Promega, G980A). For each transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... packed column (now loaded with the protein sample) 20 µL of Trypsin digestion solution (1 µg MS-grade Trypsin (Promega) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were plated at a density of 1*10^6 per 10cm plate and transfected on the following day using Fugene HD (Promega, Madison ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells in a 6-cm dish were transiently transfected with 1 μg of pGloSensor-22F cAMP plasmid (Promega, USA) and 1 μg of human wild-type or mutated A2AR or A2BR overexpression plasmid using polyethyleneglycol (6 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 in storage buffer and analyzed as indicated in the manufacturer’s protocol (LDH-Glo Cytotoxicity Assay, Promega, #J2381).
-
bioRxiv - Cell Biology 2023Quote: ... Isolated proteins were digested with 1:50 w/w LysC (Wako Chemicals, cleaves at the carboxylic side of lysine residue) and 1:100 w/w trypsin (Promega, Sequencing-grade ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...